Glyma19g31361 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g31361): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g31361): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma19g31361

Feature Type:	gene_model
Chromosome:	Gm19
Start:	39154388
stop:	39156213
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g31361

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G56970	AT	Annotation by Michelle Graham. TAIR10: basic helix-loop-helix (bHLH) DNA-binding superfamily protein \| chr3:21084204-21085094 REVERSE LENGTH=253	SoyBase	E_val: 2.00E-25	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0055072	GO-bp	Annotation by Michelle Graham. GO Biological Process: iron ion homeostasis	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
PTHR13935	Panther	ACHAETE-SCUTE TRANSCRIPTION FACTOR-RELATED	JGI		ISS
PTHR13935:SF2	Panther	ACHAETE-SCUTE HOMOLOG 2	JGI		ISS
PF00010	PFAM	Helix-loop-helix DNA-binding domain	JGI		ISS
UniRef100_D7LVM0	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: OBP3-responsive gene 3 (Fragment) n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7LVM0_ARALL	SoyBase	E_val: 3.00E-23	ISS
UniRef100_UPI000233ECE4	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233ECE4 related cluster n=1 Tax=unknown RepID=UPI000233ECE4	SoyBase	E_val: 4.00E-68	ISS

Expression Patterns of Glyma19g31361

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g31361 not represented in the dataset	Glyma19g31361 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma19g31361 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g132600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g31361

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g31361

Limit To All Plant Sequences

>Glyma19g31361.1   sequence type=CDS   gene model=Glyma19g31361   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTTGCTTTGTTTTCTCCTACTGTGTTCTCAACCAAGGGATGGCTCTTAGAGGAGGAGCCATTAAGCTATGATGTGTCCTCAAAGAACTCATTTCCCTATCAATTTTATTCACTACAGACACAGATTGAGGTTGAAATAGAAAGGTCAACTGCACCATCCCCTGATGACCCTGCCATGGTCAAGAAGCTTAGCCACAACGCTAGTGAACGTGATCGCCGCAAGAAGGTCAATAATCTGGTTTCTTCACTTCGTTTACTTCTTCCAGTGGAAGATCAAACGAAAAAAATGAGTATTCCGGCGACAGTTTCGCGAGTCTTAAAATACATACCTGAGTTGCAACACCAAATGTAA

Predicted protein sequences of Glyma19g31361

Limit To All Plant Sequences

>Glyma19g31361.1   sequence type=predicted peptide   gene model=Glyma19g31361   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVALFSPTVFSTKGWLLEEEPLSYDVSSKNSFPYQFYSLQTQIEVEIERSTAPSPDDPAMVKKLSHNASERDRRKKVNNLVSSLRLLLPVEDQTKKMSIPATVSRVLKYIPELQHQM*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain