Glyma19g30630 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g30630

Feature Type:	gene_model
Chromosome:	Gm19
Start:	38245858
stop:	38249157
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g30630

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G48570	AT	Annotation by Michelle Graham. TAIR10: FKBP-type peptidyl-prolyl cis-trans isomerase family protein \| chr5:19690746-19693656 REVERSE LENGTH=578	SoyBase	E_val: 4.00E-113	ISS
GO:0000413	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein peptidyl-prolyl isomerization	SoyBase	N/A	ISS
GO:0006457	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein folding	SoyBase	N/A	ISS
GO:0006499	GO-bp	Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation	SoyBase	N/A	ISS
GO:0009408	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to heat	SoyBase	N/A	ISS
GO:0009644	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to high light intensity	SoyBase	N/A	ISS
GO:0018208	GO-bp	Annotation by Michelle Graham. GO Biological Process: peptidyl-proline modification	SoyBase	N/A	ISS
GO:0034976	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to endoplasmic reticulum stress	SoyBase	N/A	ISS
GO:0042542	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to hydrogen peroxide	SoyBase	N/A	ISS
GO:0070370	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular heat acclimation	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005773	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuole	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0003755	GO-mf	Annotation by Michelle Graham. GO Molecular Function: peptidyl-prolyl cis-trans isomerase activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0005516	GO-mf	Annotation by Michelle Graham. GO Molecular Function: calmodulin binding	SoyBase	N/A	ISS
GO:0005528	GO-mf	Annotation by Michelle Graham. GO Molecular Function: FK506 binding	SoyBase	N/A	ISS
KOG0543	KOG	FKBP-type peptidyl-prolyl cis-trans isomerase	JGI		ISS
PTHR10516	Panther	FK506 BINDING PROTEIN	JGI		ISS
PTHR10516:SF66	Panther	PEPTIDYL-PROLYL CIS-TRANS ISOMERASE	JGI		ISS
PF00254	PFAM	FKBP-type peptidyl-prolyl cis-trans isomerase	JGI		ISS
UniRef100_I1N8N0	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Peptidyl-prolyl cis-trans isomerase (Fragment) n=1 Tax=Glycine max RepID=I1N8N0_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_I1N8N0	UniRef	Annotation by Michelle Graham. Best UniRef hit: Peptidyl-prolyl cis-trans isomerase (Fragment) n=1 Tax=Glycine max RepID=I1N8N0_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma19g30630

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g30630

Paralog	Evidence	Comments
Glyma03g27750	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g30630 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma19g30630

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g30630

Limit To All Plant Sequences

>Glyma19g30630.1   sequence type=CDS   gene model=Glyma19g30630   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CTAAGCCAGTCTCTGGAAAATGAACTGAAAGGTGCTGAAGACTCCGAATTCCCTGTGAAGGAAATTGGAAATGAAGGTCTCACAAAACGGATTCTCAGAAAAGGAGTCACTTGGCAAAGTCCATTCTCTGGAGATGAAGTGGAAGTTCATTTCAGAGGACAAGTTGAAAACGGAGCAGCTCTTGAATCGAGTTATGATAAAGGGTCCCGGTTTCGTTTCAAATTAGGCCAATTTATCAAAGGTTGGGATGAAGGAGTTGCCACCATGAAGAAAGGGGAGAGTGCAATCTTCAAAATACCACCTAACTTGGCATATGGGGAAGAAGGGTCCCCTCCATTGATTCCTCCTAATGCTACTCTCATTTTGACATTGAAATGGTGTCTTGGAAAAAAGATCATACGGGAGGGAGAAGGATGGGCTACTCCCAGAGAAGCTGATGAGGTGCTAGTGAAATATGAAGCCAGACTAGAGAATGGGATGCTTGTCTCCAAGTCTGATCAGGGAGTCGAGTTTAATTGTTATTCTCCCATCAAAACTAAGAACGGGCTCGGTCAAAATTCAAATAAAATCACTGAGCTAGACGGTGTTCTTCCAGCAGATTCTAATTTAACTTGCATCAAGCTTGAGTTGGTATCATTGAAAATTGTTACTGATGTCACGGGAGATAAGAAGATACTTAAAAAAATTAAGAAAGCGGGTGAGGGGTTTGATCATCCTAACGAGGGATCCCAAGTGAAAGTGATATATTTGTGTAAAGGGGAAGATGGTACGGTTATTGAAAGCAAAGGATCAGAGGAAGAACCTTTTGAGTTGACAACTCAGGAAGAACCGGTACCCGAGGGTCTAGAAAGAGCAATAATGACAACGAAGAAAGGAGAACAAGCTCTTGTGACCTTGCTCCTATCCTATGTATTGCAATTTGTAAATATTAGTTTCATTAATATGAAAAGGGAAATATGTGTGGAGTTTTCCAAAGAATACAATAGGTCAAGTATTCATGCGGTGTTATACTATTCTCAAATTAATGTTTGTTGTGAAAAGGAAGAACCATTTTGGAAAATGGACACACAAGAGAAAATAGAAGTTTGTGAGAGGAAGAAGCATGATGGAAATCTGCTGTTCAAGGTTGAAAATTTCAGGCGCGCATCCAAGAAATATGAAAAGGCTGTAAAATACATAGAATTTGATCACTCATTTAGTGAAGATGAGAAGCATCGTGATAATACTTTACGTTTATCCTGTAATTTGAACAATGCTGCCGGTAAACTAAAATTGGGGGAGTACATTGAAGCATTGTGCACAAAGGTACTCATACTCTCTTGTCCTAATTTGAGTATTTTTTTTTTCTATCTCCATGTTTCTCCTTCCCCTGATGAGACATGCAAGAAAGAAAACGTCGCATGA

Predicted protein sequences of Glyma19g30630

Limit To All Plant Sequences

>Glyma19g30630.1   sequence type=predicted peptide   gene model=Glyma19g30630   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
LSQSLENELKGAEDSEFPVKEIGNEGLTKRILRKGVTWQSPFSGDEVEVHFRGQVENGAALESSYDKGSRFRFKLGQFIKGWDEGVATMKKGESAIFKIPPNLAYGEEGSPPLIPPNATLILTLKWCLGKKIIREGEGWATPREADEVLVKYEARLENGMLVSKSDQGVEFNCYSPIKTKNGLGQNSNKITELDGVLPADSNLTCIKLELVSLKIVTDVTGDKKILKKIKKAGEGFDHPNEGSQVKVIYLCKGEDGTVIESKGSEEEPFELTTQEEPVPEGLERAIMTTKKGEQALVTLLLSYVLQFVNISFINMKREICVEFSKEYNRSSIHAVLYYSQINVCCEKEEPFWKMDTQEKIEVCERKKHDGNLLFKVENFRRASKKYEKAVKYIEFDHSFSEDEKHRDNTLRLSCNLNNAAGKLKLGEYIEALCTKVLILSCPNLSIFFFYLHVSPSPDETCKKENVA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain