SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g30600

Feature Type:gene_model
Chromosome:Gm19
Start:38217222
stop:38222383
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g30600
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G40890AT Annotation by Michelle Graham. TAIR10: cytochrome P450, family 98, subfamily A, polypeptide 3 | chr2:17058291-17060532 REVERSE LENGTH=508 SoyBaseE_val: 0ISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009699GO-bp Annotation by Michelle Graham. GO Biological Process: phenylpropanoid biosynthetic process SoyBaseN/AISS
GO:0009805GO-bp Annotation by Michelle Graham. GO Biological Process: coumarin biosynthetic process SoyBaseN/AISS
GO:0009809GO-bp Annotation by Michelle Graham. GO Biological Process: lignin biosynthetic process SoyBaseN/AISS
GO:0009813GO-bp Annotation by Michelle Graham. GO Biological Process: flavonoid biosynthetic process SoyBaseN/AISS
GO:0009963GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of flavonoid biosynthetic process SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0043231GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular membrane-bounded organelle SoyBaseN/AISS
GO:0004497GO-mf Annotation by Michelle Graham. GO Molecular Function: monooxygenase activity SoyBaseN/AISS
GO:0005506GO-mf Annotation by Michelle Graham. GO Molecular Function: iron ion binding SoyBaseN/AISS
GO:0009055GO-mf Annotation by Michelle Graham. GO Molecular Function: electron carrier activity SoyBaseN/AISS
GO:0016705GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen SoyBaseN/AISS
GO:0020037GO-mf Annotation by Michelle Graham. GO Molecular Function: heme binding SoyBaseN/AISS
GO:0046409GO-mf Annotation by Michelle Graham. GO Molecular Function: p-coumarate 3-hydroxylase activity SoyBaseN/AISS
KOG0156 KOG Cytochrome P450 CYP2 subfamily JGI ISS
PTHR24298Panther FAMILY NOT NAMED JGI ISS
PTHR24298:SF44Panther JGI ISS
PF00067PFAM Cytochrome P450 JGI ISS
UniRef100_O48922UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cytochrome P450 98A2 n=1 Tax=Glycine max RepID=C98A2_SOYBN SoyBaseE_val: 0ISS
UniRef100_O48922UniRef Annotation by Michelle Graham. Best UniRef hit: Cytochrome P450 98A2 n=1 Tax=Glycine max RepID=C98A2_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma19g30600
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g30600
ParalogEvidenceComments
Glyma03g27740 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g30600 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g126000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma19g30600
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g30600
>Glyma19g30600.1   sequence type=CDS   gene model=Glyma19g30600   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGCTGCTTCTGATAATTCCCATCTCACTGGTCACCCTCTGGCTCGGTTACACCCTATACCAGCGATTAAGATTCAAGCTCCCTCCGGGTCCACGGCCCTGGCCGGTAGTCGGTAACCTCTACGACATAAAACCCGTCCGCTTCCGGTGCTTCGCGGAGTGGGCGCAGTCTTACGGCCCCATAATATCGGTTTGGTTCGGTTCGACCCTAAACGTCATCGTTTCGAACTCGGAGCTGGCGAAGGAGGTGCTGAAGGAGCACGATCAGCTGCTGGCGGACCGCCACCGGAGCCGGTCGGCGGCGAAGTTCAGCCGCGACGGGAAGGATCTAATTTGGGCCGATTATGGGCCGCACTACGTGAAGGTGAGGAAGGTTTGCACGCTCGAGCTTTTCTCGCCGAAGCGCCTCGAGGCCCTGAGGCCCATTAGGGAGGACGAGGTCACCTCCATGGTTGACTCCGTTTACAATCACTGCACCAGCACTGAAAATTTGGGGAAAGGAATATTGTTGAGGAAGCACTTGGGGGTTGTGGCATTCAACAACATAACCAGGTTGGCATTTGGGAAAAGATTTGTGAACTCAGAAGGTGTGATGGATGAGCAAGGAGTAGAATTCAAGGCCATTGTGGAAAATGGGTTAAAGCTAGGAGCATCTCTAGCCATGGCAGAACACATCCCTTGGCTTCGCTGGATGTTCCCACTGGAAGAAGGAGCTTTTGCCAAGCATGGAGCCCGCCGCGACCGACTCACCAGAGCCATCATGGCAGAGCACACTGAAGCACGCAAGAAATCTGGTGGTGCCAAGCAACATTTTGTTGATGCCCTCCTCACATTGCAAGACAAATATGACCTTAGTGAAGACACCATCATTGGTCTCCTTTGGGATATGATCACAGCAGGGATGGACACAACTGCAATTTCAGTTGAGTGGGCCATGGCTGAGTTGATAAGAAACCCAAGGGTGCAACAAAAGGTCCAAGAGGAGCTAGACAGGGTAATTGGGCTTGAAAGGGTGATGACTGAAGCAGACTTCTCAAATCTCCCTTACCTACAATGTGTGACCAAAGAAGCAATGAGGCTTCACCCACCAACCCCACTAATGCTCCCACACCGTGCCAATGCCAATGTCAAAGTTGGAGGCTATGACATTCCCAAAGGGTCCAATGTGCATGTGAATGTGTGGGCGGTGGCCCGCGACCCGGCCGTGTGGAAGGATCCATTGGAGTTCCGACCCGAAAGGTTCCTTGAGGAGGATGTAGACATGAAGGGCCATGACTTTAGGCTACTTCCATTCGGGTCGGGTCGACGAGTATGCCCGGGTGCCCAACTTGGTATCAACTTGGCAGCATCCATGTTGGGCCACCTCTTGCACCATTTCTGTTGGACCCCACCTGAAGGAATGAAGCCTGAGGAAATTGACATGGGAGAGAATCCAGGGCTAGTCACATACATGAGGACTCCAATACAAGCTGTGGTTTCTCCTAGGCTCCCCTCACATTTATACAAACGTGTGCCTGCTGAGATCTAA
Predicted protein sequences of Glyma19g30600
>Glyma19g30600.1   sequence type=predicted peptide   gene model=Glyma19g30600   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALLLIIPISLVTLWLGYTLYQRLRFKLPPGPRPWPVVGNLYDIKPVRFRCFAEWAQSYGPIISVWFGSTLNVIVSNSELAKEVLKEHDQLLADRHRSRSAAKFSRDGKDLIWADYGPHYVKVRKVCTLELFSPKRLEALRPIREDEVTSMVDSVYNHCTSTENLGKGILLRKHLGVVAFNNITRLAFGKRFVNSEGVMDEQGVEFKAIVENGLKLGASLAMAEHIPWLRWMFPLEEGAFAKHGARRDRLTRAIMAEHTEARKKSGGAKQHFVDALLTLQDKYDLSEDTIIGLLWDMITAGMDTTAISVEWAMAELIRNPRVQQKVQEELDRVIGLERVMTEADFSNLPYLQCVTKEAMRLHPPTPLMLPHRANANVKVGGYDIPKGSNVHVNVWAVARDPAVWKDPLEFRPERFLEEDVDMKGHDFRLLPFGSGRRVCPGAQLGINLAASMLGHLLHHFCWTPPEGMKPEEIDMGENPGLVTYMRTPIQAVVSPRLPSHLYKRVPAEI*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo