Glyma19g29741 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g29741

Feature Type:	gene_model
Chromosome:	Gm19
Start:	37466991
stop:	37472629
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g29741

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G03630	AT	Annotation by Michelle Graham. TAIR10: cysteine synthase 26 \| chr3:878388-880400 REVERSE LENGTH=404	SoyBase	E_val: 2.00E-167	ISS
GO:0009643	GO-bp	Annotation by Michelle Graham. GO Biological Process: photosynthetic acclimation	SoyBase	N/A	ISS
GO:0010310	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process	SoyBase	N/A	ISS
GO:0015979	GO-bp	Annotation by Michelle Graham. GO Biological Process: photosynthesis	SoyBase	N/A	ISS
GO:0019344	GO-bp	Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process	SoyBase	N/A	ISS
GO:0090322	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of superoxide metabolic process	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0031977	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: thylakoid lumen	SoyBase	N/A	ISS
GO:0003824	GO-mf	Annotation by Michelle Graham. GO Molecular Function: catalytic activity	SoyBase	N/A	ISS
GO:0004124	GO-mf	Annotation by Michelle Graham. GO Molecular Function: cysteine synthase activity	SoyBase	N/A	ISS
GO:0030170	GO-mf	Annotation by Michelle Graham. GO Molecular Function: pyridoxal phosphate binding	SoyBase	N/A	ISS
KOG1252	KOG	Cystathionine beta-synthase and related enzymes	JGI		ISS
PTHR10314	Panther	PYRIDOXAL-5-PHOSPHATE DEPENDENT BETA FAMILY	JGI		ISS
PTHR10314:SF8	Panther	THREONINE DEHYDRATASE	JGI		ISS
PF00291	PFAM	Pyridoxal-phosphate dependent enzyme	JGI		ISS
UniRef100_G7L2L5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Cysteine synthase n=1 Tax=Medicago truncatula RepID=G7L2L5_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_UPI000233E31F	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233E31F related cluster n=1 Tax=unknown RepID=UPI000233E31F	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma19g29741

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g29741 not represented in the dataset	Glyma19g29741 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g29741

Paralog	Evidence	Comments
Glyma03g00900	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g29741 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g119200	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g29741

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g29741

Limit To All Plant Sequences

>Glyma19g29741.1   sequence type=CDS   gene model=Glyma19g29741   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGAATGGCGCTATCTTCATTTTCATTACCGTGTTTGTGTTATTGCACTTCAACGCTGGTTCCCTTCAATCTCACTCGGCTCCAACTGGTTAGCCTCAAACCCTATACTCGTTCTCAATCTCAGCACACCGCCGCTAAAGCTAAAGTTTCTTCTGCTCCGTTAGTGTACTCCACCAGACAAGGGTTTGACACCGTCAACATTGCCGAAGATGTCACCCAGTTGATTGGAAATACACCAATGGTGTACCTCAATAAGGTTACAGAAGGTTGTGTGGCTAACATTGCTGCGAAACTCGAGTCTATGGAACCTTGCCGAAGTGTCAAGGATAGAATAGGCTATAGTATGCTATCTGATGCTGAAGAGATTGGAGCAATTTCTCCTGGGAAGACCATTTTGGTTGAACCAACAACTGGAAATACAGGACTTGGCATTGCTTTTGTTGCAGCAACAAAGGGGTACAAACTTATAGTCACAATGCCTGCTTCTATTAATGTTGAGAGAAGAATCCTTTTACGTGCATTTGGTGCAGAGGTTGTTCTGACTGATGCTGAGAAAGGGCTAAAAGGGGCAGTTGACAAAGCTGAAGAAATTGTTCGCAACACACCCAATGCGTACATGTTTCGGCAGTTTGATAACATGACTAATACAAAGATCCACTTCGAAACTACAGGGCCAGAGATATGGGAGGATACCATGGGTAATGTTGATGTATTGGTAGCTGGGATTGGAACTGGTGGCACCGTTACTGGCACTGGACGTTATCTGAAAATGATGAACAAAAATATAAAGGTGGTTGGGGTGGAACCTGCAGACAGAAGTGTTGTTTCGGGTGACAGTCCTGGTTTCATGCCAAGCATTTTGGATATCAAACTGCTTGATGAAGTTATCAAGGTTACAAATGTTGAAGCTGTCGAAATGGCAAGGAGATTAGCATTGAAAGAAGGTTTGCTGGTTGGGATTTCTTCAGGAGCTGCAGCAGCTGCTGCCATAAATTTAGCAAGACGGCCTGAGCATTCTGGGAAACTTATTGTGGTTATTTTTCCAAGTTTTGGTGAGAGATATATTTCTACTGCTCTCTTCCATTCTATCTATGAAGAGGTTCAGAAAATGTAA

Predicted protein sequences of Glyma19g29741

Limit To All Plant Sequences

>Glyma19g29741.1   sequence type=predicted peptide   gene model=Glyma19g29741   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRMALSSFSLPCLCYCTSTLVPFNLTRLQLVSLKPYTRSQSQHTAAKAKVSSAPLVYSTRQGFDTVNIAEDVTQLIGNTPMVYLNKVTEGCVANIAAKLESMEPCRSVKDRIGYSMLSDAEEIGAISPGKTILVEPTTGNTGLGIAFVAATKGYKLIVTMPASINVERRILLRAFGAEVVLTDAEKGLKGAVDKAEEIVRNTPNAYMFRQFDNMTNTKIHFETTGPEIWEDTMGNVDVLVAGIGTGGTVTGTGRYLKMMNKNIKVVGVEPADRSVVSGDSPGFMPSILDIKLLDEVIKVTNVEAVEMARRLALKEGLLVGISSGAAAAAAINLARRPEHSGKLIVVIFPSFGERYISTALFHSIYEEVQKM*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain