Glyma19g29380 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g29380

Feature Type:	gene_model
Chromosome:	Gm19
Start:	36948703
stop:	36951717
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g29380

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G31220	AT	Annotation by Michelle Graham. TAIR10: Formyl transferase \| chr1:11157064-11158408 FORWARD LENGTH=292	SoyBase	E_val: 7.00E-111	ISS
GO:0006189	GO-bp	Annotation by Michelle Graham. GO Biological Process: 'de novo' IMP biosynthetic process	SoyBase	N/A	ISS
GO:0009058	GO-bp	Annotation by Michelle Graham. GO Biological Process: biosynthetic process	SoyBase	N/A	ISS
GO:0009152	GO-bp	Annotation by Michelle Graham. GO Biological Process: purine ribonucleotide biosynthetic process	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0004644	GO-mf	Annotation by Michelle Graham. GO Molecular Function: phosphoribosylglycinamide formyltransferase activity	SoyBase	N/A	ISS
GO:0008168	GO-mf	Annotation by Michelle Graham. GO Molecular Function: methyltransferase activity	SoyBase	N/A	ISS
GO:0008864	GO-mf	Annotation by Michelle Graham. GO Molecular Function: formyltetrahydrofolate deformylase activity	SoyBase	N/A	ISS
GO:0016742	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydroxymethyl-, formyl- and related transferase activity	SoyBase	N/A	ISS
KOG3076	KOG	5'-phosphoribosylglycinamide formyltransferase	JGI		ISS
PTHR10520	Panther	PHOSPHORIBOSYLAMINE-GLYCINE LIGASE	JGI		ISS
PF00551	PFAM	Formyl transferase	JGI		ISS
UniRef100_Q7XJ86	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Glycinamide ribonucleotide transformylase n=1 Tax=Glycine max RepID=Q7XJ86_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q7XJ86	UniRef	Annotation by Michelle Graham. Best UniRef hit: Glycinamide ribonucleotide transformylase n=1 Tax=Glycine max RepID=Q7XJ86_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma19g29380

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g29380

Paralog	Evidence	Comments
Glyma16g04120	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g29380 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g115900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g29380

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g29380

Limit To All Plant Sequences

>Glyma19g29380.1   sequence type=CDS   gene model=Glyma19g29380   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCCATGGAAGCTCAACAGATTCTTTCCAGATTCTGTCCAAAACCATCTTCAGTGCCATCTATTCCAATTGTGAAACAACAATTCTCTCCAAAGTTCCCTCGTTTACCTTCTTCATCGTTGTATCCTTCTAGTCAATCTCAGAATCTCAATGTTCCTAGTGGAGCTTTCCATCCTATCAGCATTGTGCACAAAGAAGTGTGTTCTAGTTCTTGCAAGAGGATATGGTGCAGCAGCAGCAGCAGCAGCACTGCAGAACCAAAGGAGGGCCATGAGGTGAGGGCTCAGGTCACCGTGCGAAGGAAAAAGCTAGCAGTTTTCGTTTCTGGTGGAGGATCCAACTTCAGAGCAATTCATGAGGCCTCCAAAAGGGGATCACTTCATGGAGATGTTCTTGTGTTGGTCACAAATAAAAGTGATTGTGGAGGTGCGGAGTATGCAAGAAATAATGGTATCCCAGTTATACTGTACCATATATCAAAGGATGAATCTAATCCAAGTGACCTTGTTGATACACTAAGGAAATTTGAGGTTGATTTTATTCTTTTAGCTGGATACCTCAAACTTATACCAGTGGAATTGATCCGAGCTTACAAAAGATCTATATTCAACATTCATCCATCACTTCTTCCAGCTTTTGGAGGCAAGGGATTCTATGGCATGAAAGTGCACAAAGCAGTAATTGCTTCTGGAGCAAGGTTTTCAGGTCCTACCATTCATTTTGTTGATGAACACTATGATACAGGGCGTATCCTTGCACAGCGTGTTGTCCCTGTGCTTGCCAATGATACTGTAGAAGAGCTGGCTGCAAGGGTTCTCAAAGAGGAGCACCAATTATATGTGGAGGTGGTGGAGGCTTTATGCGAAGAACGTGTGGTTTGGAGGCAAGATGGTGTTCCTCTCATCCAAAGCAAAGAAAACCCCAATGAGTTTCGCTGA

Predicted protein sequences of Glyma19g29380

Limit To All Plant Sequences

>Glyma19g29380.1   sequence type=predicted peptide   gene model=Glyma19g29380   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSMEAQQILSRFCPKPSSVPSIPIVKQQFSPKFPRLPSSSLYPSSQSQNLNVPSGAFHPISIVHKEVCSSSCKRIWCSSSSSSTAEPKEGHEVRAQVTVRRKKLAVFVSGGGSNFRAIHEASKRGSLHGDVLVLVTNKSDCGGAEYARNNGIPVILYHISKDESNPSDLVDTLRKFEVDFILLAGYLKLIPVELIRAYKRSIFNIHPSLLPAFGGKGFYGMKVHKAVIASGARFSGPTIHFVDEHYDTGRILAQRVVPVLANDTVEELAARVLKEEHQLYVEVVEALCEERVVWRQDGVPLIQSKENPNEFR*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain