Glyma19g28880 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g28880

Feature Type:	gene_model
Chromosome:	Gm19
Start:	36429775
stop:	36433731
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g28880

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G18140	AT	Annotation by Michelle Graham. TAIR10: Chaperone DnaJ-domain superfamily protein \| chr5:5998235-5999699 FORWARD LENGTH=333	SoyBase	E_val: 1.00E-98	ISS
GO:0006457	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein folding	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0031072	GO-mf	Annotation by Michelle Graham. GO Molecular Function: heat shock protein binding	SoyBase	N/A	ISS
GO:0051082	GO-mf	Annotation by Michelle Graham. GO Molecular Function: unfolded protein binding	SoyBase	N/A	ISS
KOG0715	KOG	Molecular chaperone (DnaJ superfamily)	JGI		ISS
PTHR24077	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24077:SF89	Panther		JGI		ISS
PF00226	PFAM	DnaJ domain	JGI		ISS
UniRef100_I1N887	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N887_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q9FK56	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Chaperone DnaJ-domain containing protein n=1 Tax=Arabidopsis thaliana RepID=Q9FK56_ARATH	SoyBase	E_val: 7.00E-96	ISS

Expression Patterns of Glyma19g28880

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g28880

Paralog	Evidence	Comments
Glyma16g04540	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g28880 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g112100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g28880

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g28880

Limit To All Plant Sequences

>Glyma19g28880.1   sequence type=CDS   gene model=Glyma19g28880   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAATCGCACCTTCTAGTGGGACCCATCTCCGCCGCACGCTATGGTTGCGCCGCCAATTCCAGCCACTTTCACTCCGCCGCATCCTCCACCTGGGCCAACTCTCCTCGCCGGCGGTCTCCACTCGTCATGGCCTCCTCGTCGTCTGCCGCCGTCAACGGCGGCCAGAACTACTACGCCGTTCTCGGTGTCGCCCGCACTGCCACCACCGTCCAAATCAAACGCGCTTATCGCCTCCTCGCCCGCAAGTATCATCCTGATGTTAGCAAGGATCCACACGCTGCTGAATTATTCAAGAGCATCCATCATGCATATGAAGTCCTATCTAATGAAGCAACGAGAGTTCAGTATGATCAAGAACTTCAATTTGGTCACAAGCCTTACAGGGAAAAATGGAGTTACAGCACTGAATTTGAAGATCAGGCAAGATTCTATAGGTGGGACCGCATGAGGAAAAAAATGGATAGGGAAAGATACTGGGAGAATTACAATGTCAATGAGGACTACTACACCAGTGAAACAGATGAGGAAGAAGATGAAGTAGTAGATTTAGATGAAGAGAGGGGTTCTTTTGTTGAAGTGCTTAGATCAGCATTCATGTCATTATTTTTGCTTCAGACGCTTGGATCCCGTTTCTCACTCACATTCAGCAGTCTGATGGCATTGTTTGATAAGAAATTAGACACCGGCTATAAAATGGGCTATGTAATAGCATGGATTTTGGGTGGGAGGGGTGGCATATTGCTAACACTATGCTTGTCATTTGCAAGTTGGGTTTGCGGGAAAACCAGTAGTAGTGTTGTCGCACTAGTTGTGGTGGCCTTGTGGGTTGGCTCATACCTTGCAAGGTATGCACCACTTCCCCAAGGTGCTCTATTAGCTCTTCTCTACATGTCCATTAAGCTACAGTCTGACCTAATATAA

Predicted protein sequences of Glyma19g28880

Limit To All Plant Sequences

>Glyma19g28880.1   sequence type=predicted peptide   gene model=Glyma19g28880   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MESHLLVGPISAARYGCAANSSHFHSAASSTWANSPRRRSPLVMASSSSAAVNGGQNYYAVLGVARTATTVQIKRAYRLLARKYHPDVSKDPHAAELFKSIHHAYEVLSNEATRVQYDQELQFGHKPYREKWSYSTEFEDQARFYRWDRMRKKMDRERYWENYNVNEDYYTSETDEEEDEVVDLDEERGSFVEVLRSAFMSLFLLQTLGSRFSLTFSSLMALFDKKLDTGYKMGYVIAWILGGRGGILLTLCLSFASWVCGKTSSSVVALVVVALWVGSYLARYAPLPQGALLALLYMSIKLQSDLI*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain