Report for Sequence Feature Glyma19g28600
Feature Type: gene_model
Chromosome: Gm19
Start: 36187569
stop: 36189044
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma19g28600
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT2G19440 AT
Annotation by Michelle Graham. TAIR10: O-Glycosyl hydrolases family 17 protein | chr2:8418164-8419806 REVERSE LENGTH=478
SoyBase E_val: 3.00E-133 ISS
GO:0005975 GO-bp
Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process
SoyBase N/A ISS
GO:0005886 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane
SoyBase N/A ISS
GO:0031225 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: anchored to membrane
SoyBase N/A ISS
GO:0003824 GO-mf
Annotation by Michelle Graham. GO Molecular Function: catalytic activity
SoyBase N/A ISS
GO:0004553 GO-mf
Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds
SoyBase N/A ISS
GO:0043169 GO-mf
Annotation by Michelle Graham. GO Molecular Function: cation binding
SoyBase N/A ISS
PTHR16631 Panther
GLUCAN 1,3-BETA-GLUCOSIDASE-RELATED
JGI ISS
PTHR16631:SF1 Panther
GLUCAN 1,3-BETA-GLUCOSIDASE
JGI ISS
PF00332 PFAM
Glycosyl hydrolases family 17
JGI ISS
PF07983 PFAM
X8 domain
JGI ISS
UniRef100_A2Q5Q4 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Glucan endo-1,3-beta-glucosidase n=1 Tax=Medicago truncatula RepID=A2Q5Q4_MEDTR
SoyBase E_val: 4.00E-159 ISS
UniRef100_UPI000233E89B UniRef
Annotation by Michelle Graham. Best UniRef hit: UPI000233E89B related cluster n=1 Tax=unknown RepID=UPI000233E89B
SoyBase E_val: 0 ISS
Expression Patterns of Glyma19g28600
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma19g28600
Paralog Evidence Comments
Glyma16g04680 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma19g28600 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.19g109900 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma19g28600
Coding sequences of Glyma19g28600
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma19g28600.2 sequence type=CDS gene model=Glyma19g28600 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGACTCTGACGCTTAAGGAAGTACTACACTATATATTCTTTTGTAGGTATGTAGCAGTTGGGAACAAGCCATTTTTGAAATCCTACAACAATTCATTCTTGAATATCACCTTCCCTCCACTGCATAAAATTCAAAATGCCCTTAATGAAGCAGGTCTTGGAGACAAAATAAAGGTCATAGTGTCCTTGAATGCAGATGTTAACCAGTCTCCAGAGAATAATCATGTTCCATCTGCAGGAATATTTAGGCCCTATATATCAGTGAATGGCGTGCCATTTACCATGAACATTTACCCCTTCTTAAGTCTTTATGGTAACGATGATTTTCCTTTCAACTACGCCTTCTTCGATGGTGTAGACAATCCGGAAAACGATAACGTTGGGTTTGGGGACCTGCCTATTTTGGTGGGAGAAGTAGGATGGCCTACTGAAGGGGACAAGAATGCCAACACAGGCAATGCTTTGAGATTCTATAATGGTCTTCTGCCGAGGCTTGCAGCAAATCGAGGCACCCCGCGCCGCCCTGGATACATTGAAGTTTATCTATTCGGATTCATCGATGAGGATGCCAAGAGCATTGCTCCGGGAAACTTAGAACGCCATTGGGGGACATTCAGATACGATGGACAACCTAAGTTTCCAATGGACCTTTCTGGTCAGAACCAAAACAAATTTCTCGTAGGTACACAGAATATAACACTAACTATGCTTGCACCTTTGGATTGCACGGCGCTTGGATACGGTTGTTCTTGCAACAATTTGGATTTGAATGGGAACGCCTCTTATGCGTTTAATATGTACTTCCAGGTGCAAAATCAGAACCCCATGGGGTGCGATTTTCAAGGTTTGTCCAAGCTTACTACGGACAATATCTCAACACCCACTGGCAATTTTATCGTTCAGATAGTTAGTTCTTCAGGCTCTTCTCTGATGCCCTCGCTTGCTGCTACCTTGTTTGTTAGTTTATTCATGATTCTGTTTTCTTAG
Predicted protein sequences of Glyma19g28600
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma19g28600.2 sequence type=predicted peptide gene model=Glyma19g28600 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MTLTLKEVLHYIFFCRYVAVGNKPFLKSYNNSFLNITFPPLHKIQNALNEAGLGDKIKVIVSLNADVNQSPENNHVPSAGIFRPYISVNGVPFTMNIYPFLSLYGNDDFPFNYAFFDGVDNPENDNVGFGDLPILVGEVGWPTEGDKNANTGNALRFYNGLLPRLAANRGTPRRPGYIEVYLFGFIDEDAKSIAPGNLERHWGTFRYDGQPKFPMDLSGQNQNKFLVGTQNITLTMLAPLDCTALGYGCSCNNLDLNGNASYAFNMYFQVQNQNPMGCDFQGLSKLTTDNISTPTGNFIVQIVSSSGSSLMPSLAATLFVSLFMILFS*