SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g28240

Feature Type:gene_model
Chromosome:Gm19
Start:35628976
stop:35631849
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g28240
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G12900AT Annotation by Michelle Graham. TAIR10: glyceraldehyde 3-phosphate dehydrogenase A subunit 2 | chr1:4392634-4394283 REVERSE LENGTH=399 SoyBaseE_val: 0ISS
GO:0006006GO-bp Annotation by Michelle Graham. GO Biological Process: glucose metabolic process SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0009657GO-bp Annotation by Michelle Graham. GO Biological Process: plastid organization SoyBaseN/AISS
GO:0009773GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthetic electron transport in photosystem I SoyBaseN/AISS
GO:0010103GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal complex morphogenesis SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0019684GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0016620GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor SoyBaseN/AISS
GO:0050661GO-mf Annotation by Michelle Graham. GO Molecular Function: NADP binding SoyBaseN/AISS
GO:0051287GO-mf Annotation by Michelle Graham. GO Molecular Function: NAD binding SoyBaseN/AISS
KOG0657 KOG Glyceraldehyde 3-phosphate dehydrogenase JGI ISS
PTHR10836Panther GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE JGI ISS
PF00044PFAM Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain JGI ISS
PF02800PFAM Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain JGI ISS
UniRef100_I1N843UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N843_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q38IX1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Glyceraldehyde-3-phosphate dehydrogenase A subunit n=1 Tax=Glycine max RepID=Q38IX1_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma19g28240
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g28240
ParalogEvidenceComments
Glyma16g04940 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g28240 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g106800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma19g28240
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g28240
>Glyma19g28240.1   sequence type=CDS   gene model=Glyma19g28240   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCGGCTACTCTCTCTGTAGCCAAACCAGCCCTTCAGGCAAATGGGAAAGGCTTCTCTGAATTCTCTGGCCTCCGAAGCTCATCAGGCTTCCTTCCCTTTTCTAGAAAATCTTCAGAGGATTTCCATTCTGTCATTGCCTTCCAGACCTATGCAGTTGGAAGCAGTGGAGGATACAAGAAGGGTGTGACAGAAGCAAAACTGAAGGTTGCCATAAACGGGTTTGGAAGGATTGGAAGGAACTTCTTGAGGTGCTGGCACGGTCGCAAAGACTCCCCTCTTGATGTCATTGCCATCAACGACACCGGCGGCGTGAAACAAGCCTCTCACCTTCTCAAATACGATTCCATCCTCGGAACCTTCGATGCTGATGTCAAGCCTGTTGGCAGCAATGTCATCTCCGTGGATGGAAAGGAAATCAAAGTTGTTTCTGACCGCAACCCTGCCAACCTTCCTTGGAAGGACTTGGGGATAGACTTGGTGATTGAAGGAACCGGGGTGTTTGTAGACAGAGAAGGTGCAGGGAAACACATTCAAGCAGGAGCTAAGAAGGTGCTCATCACTGCTCCTGGTAAAGGAGATATCCCCACCTACGTGGTTGGTGTCAATGAGTATGACTACAGCCCTGATGAACCCATCATCAGCAATGCCTCTTGCACCACTAACTGCCTTGCACCCTTTGTCAAGGTCCTTGATCAGAAATTCGGTATCATCAAGGGTACCATGACCACCACTCACTCCTACACCGGTGACCAAAGGCTTCTTGATGCGAGCCACCGTGACCTGAGGCGTGCAAGGGCAGCAGCACTCAACATTGTCCCCACTTCAACAGGAGCAGCAAAGGCAGTGGCCCTTGTCCTCCCAACCCTCAAAGGCAAACTCAATGGCATTGCACTCCGTGTGCCAACACCGAACGTCTCAGTGGTGGACCTCGTCGTTCAGGTCTCAAAGAAGACCTTTGCAGAAGAAGTGAATGCAGCATTCAGAGAGAGTGCAGACAATGAGCTCAAGGGAATCCTCTCTGTGTGTGATGAGCCACTTGTGTCCGTTGACTTCAGGTGCACTGATGTGTCCTCAACCGTTGACTCCTCGTTGACCATGGTCATGGGAGATGACATGGTGAAGGTCATTGCTTGGTATGACAATGAATGGGGCTACTCCCAAAGGGTTGTGGATTTGGCTGACATTGTTGCCAACAAATGGAAGTGA
Predicted protein sequences of Glyma19g28240
>Glyma19g28240.1   sequence type=predicted peptide   gene model=Glyma19g28240   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASATLSVAKPALQANGKGFSEFSGLRSSSGFLPFSRKSSEDFHSVIAFQTYAVGSSGGYKKGVTEAKLKVAINGFGRIGRNFLRCWHGRKDSPLDVIAINDTGGVKQASHLLKYDSILGTFDADVKPVGSNVISVDGKEIKVVSDRNPANLPWKDLGIDLVIEGTGVFVDREGAGKHIQAGAKKVLITAPGKGDIPTYVVGVNEYDYSPDEPIISNASCTTNCLAPFVKVLDQKFGIIKGTMTTTHSYTGDQRLLDASHRDLRRARAAALNIVPTSTGAAKAVALVLPTLKGKLNGIALRVPTPNVSVVDLVVQVSKKTFAEEVNAAFRESADNELKGILSVCDEPLVSVDFRCTDVSSTVDSSLTMVMGDDMVKVIAWYDNEWGYSQRVVDLADIVANKWK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo