SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Notice: fwrite(): Write of 157 bytes failed with errno=28 No space left on device in /var/www/html/include/SeqFeatClass.php on line 369

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g28143): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g28143): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma19g28143

Feature Type:gene_model
Chromosome:Gm19
Start:35517753
stop:35519694
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G46860AT Annotation by Michelle Graham. TAIR10: Syntaxin/t-SNARE family protein | chr5:19012342-19013795 REVERSE LENGTH=268 SoyBaseE_val: 3.00E-36ISS
GO:0000902GO-bp Annotation by Michelle Graham. GO Biological Process: cell morphogenesis SoyBaseN/AISS
GO:0006623GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to vacuole SoyBaseN/AISS
GO:0006886GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular protein transport SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0007033GO-bp Annotation by Michelle Graham. GO Biological Process: vacuole organization SoyBaseN/AISS
GO:0009556GO-bp Annotation by Michelle Graham. GO Biological Process: microsporogenesis SoyBaseN/AISS
GO:0009660GO-bp Annotation by Michelle Graham. GO Biological Process: amyloplast organization SoyBaseN/AISS
GO:0009959GO-bp Annotation by Michelle Graham. GO Biological Process: negative gravitropism SoyBaseN/AISS
GO:0010118GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal movement SoyBaseN/AISS
GO:0016049GO-bp Annotation by Michelle Graham. GO Biological Process: cell growth SoyBaseN/AISS
GO:0016192GO-bp Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport SoyBaseN/AISS
GO:0016197GO-bp Annotation by Michelle Graham. GO Biological Process: endosomal transport SoyBaseN/AISS
GO:0048193GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi vesicle transport SoyBaseN/AISS
GO:0052543GO-bp Annotation by Michelle Graham. GO Biological Process: callose deposition in cell wall SoyBaseN/AISS
GO:0000325GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plant-type vacuole SoyBaseN/AISS
GO:0005770GO-cc Annotation by Michelle Graham. GO Cellular Compartment: late endosome SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0009705GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plant-type vacuole membrane SoyBaseN/AISS
GO:0030140GO-cc Annotation by Michelle Graham. GO Cellular Compartment: trans-Golgi network transport vesicle SoyBaseN/AISS
GO:0005484GO-mf Annotation by Michelle Graham. GO Molecular Function: SNAP receptor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PTHR19957Panther SYNTAXIN JGI ISS
PTHR19957:SF11Panther SYNTAXIN-RELATED JGI ISS
PF05739PFAM SNARE domain JGI ISS
UniRef100_I1ML76UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1ML76_SOYBN SoyBaseE_val: 4.00E-74ISS
UniRef100_Q2HRW5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Syntaxin, N-terminal n=1 Tax=Medicago truncatula RepID=Q2HRW5_MEDTR SoyBaseE_val: 8.00E-67ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g28143 not represented in the dataset

Glyma19g28143 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma16g05040 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g106100 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma19g28143.1   sequence type=CDS   gene model=Glyma19g28143   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGTTTTCAAGACATCCAAATTGGCCCCAACCCTTCCTCTCGCCGGAACCAATCCCCTTCGCAGGCCGTCGCCACCGGAATTTTCCAGATCAAAACCGCCATCGCTGCTTTCCGACGACTCGTCGATGGTGTTGGAACCGTTAGACACTCCCGAACACCGTCAGAAGCTGTACCAACAAGCTCTGGCTCTGGTGAAGAATCGGTTGGGATAGATGTGGAAAGCCAACCTTTTATCAGAGAGCAGAAGAGGCAAGAGATACTTCTATTGGATAATGAAATATCCTTCAACGAGGCCATGATTGAAGAAAGAGAACAGGGAATTAGAGAGGTAGAGGAGCAAATTGAACAAGCAAATGAAATATTCAAGGACCTAGCTGTTCTGGTTCATTATCAGGGTGTTGTTATTGATGACATTCATTCAAATATTGATGCTTCTGCTGGTGCAACAACCCAAGCTAGGGTACAGCTAGCCAAGGCTTCCAAAAGTGTGAAATCCAAAACCTCATGGTGTTGGTGGGTGCTTGCAATTTTTGTGGTGGTGCTGGTCATCTTACTTGTTGTACTCATTCTTTAG

>Glyma19g28143.1   sequence type=predicted peptide   gene model=Glyma19g28143   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSFQDIQIGPNPSSRRNQSPSQAVATGIFQIKTAIAAFRRLVDGVGTVRHSRTPSEAVPTSSGSGEESVGIDVESQPFIREQKRQEILLLDNEISFNEAMIEEREQGIREVEEQIEQANEIFKDLAVLVHYQGVVIDDIHSNIDASAGATTQARVQLAKASKSVKSKTSWCWWVLAIFVVVLVILLVVLIL*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo