SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g27483

Feature Type:gene_model
Chromosome:Gm19
Start:34813718
stop:34817763
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g27483
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G26744AT Annotation by Michelle Graham. TAIR10: basic helix-loop-helix (bHLH) DNA-binding superfamily protein | chr3:9832953-9834790 REVERSE LENGTH=494 SoyBaseE_val: 1.00E-115ISS
GO:0000085GO-bp Annotation by Michelle Graham. GO Biological Process: G2 phase of mitotic cell cycle SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009410GO-bp Annotation by Michelle Graham. GO Biological Process: response to xenobiotic stimulus SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010440GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal lineage progression SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0016571GO-bp Annotation by Michelle Graham. GO Biological Process: histone methylation SoyBaseN/AISS
GO:0016579GO-bp Annotation by Michelle Graham. GO Biological Process: protein deubiquitination SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0043687GO-bp Annotation by Michelle Graham. GO Biological Process: post-translational protein modification SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048522GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of cellular process SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
PTHR23042Panther CIRCADIAN PROTEIN CLOCK/ARNT/BMAL/PAS JGI ISS
PTHR23042:SF24Panther AMS (ABORTED MICROSPORES), DNA BINDING / TRANSCRIP JGI ISS
PF00010PFAM Helix-loop-helix DNA-binding domain JGI ISS
UniRef100_B8XJY6UniRef Annotation by Michelle Graham. Best UniRef hit: Inducer of CBF expression 2 n=3 Tax=Glycine max RepID=B8XJY6_SOYBN SoyBaseE_val: 0ISS
UniRef100_B8XJY6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Inducer of CBF expression 2 n=3 Tax=Glycine max RepID=B8XJY6_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma19g27483
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g27483 not represented in the dataset
Glyma19g27483 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g27483
ParalogEvidenceComments
Glyma16g05390 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g27483 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g102000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma19g27483
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g27483
>Glyma19g27483.1   sequence type=CDS   gene model=Glyma19g27483   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAATATGGAGCGCTACACGCTACCGGCACCACCCAATATTATTCCCGAGGAAGAAGAAAACATTGCCATTGCCATGGGTGCCCCTCTTATCCCTTCCTTTAAATCCATGCTTCAACAACACCCTCAACAACTTGACTCTTACTTTAACTCTTCAATTAGTTCTACTACTATCCCTTTTGTTCCTAACATGGACTCTTTTCTCTCTCTTGACCCTTTCTCACCTTCTTTCTTCAACAACAGCAGCAGCAGCAGCAACATGGCCCTCGACCCGGGTTTTGATTTGGGCCTGGACACTGGGCTTCACTCTTCTGCTCCTGCTCCCCATCTTTTTTCCCAGGCCCAGATGATGGGCTTCGAGTTCTCGGAGCTCGAAGCCCTGGCTGGACCTGGGAATGTAAATGTCCCGTTTGCGGACGGGGCAAAGGCGGCTGCTCTGCTGCGGTCTCCTCATTTCGAGCCGCCGCAGCAGCAGCCGACGCTGTACCGGAAGCGGAGGGGGACAGCCGCGGAGATTCCGGGGCTGGAGATGGTGAGAAGGAAGGGGAGGAAGTGGCAGGAAGGAGGAGGGGAGGGTGAGGAAGGGAGCAGTGCTGACGTGGGCGGTTCCGGGTTGAACTATGAGTCTGATGAGCAGAATGAGAGCAATGGGTTGAAGCTGAGTGAGAATGGTGGAGATAACAAGGGGAAGAAGAAGGGGCTGCCCGCCAAGAATCTCATGGCGGAGAGGCGCCGCCGGAAGAAGCTCAATGATAGGTTGTACATGCTCAGGTCTGTTGTCCCCAAGATTAGCAAGATGGATAGGGCTTCAATACTTGGGGATGCAATTGACTACTTGAAGGAGTTGCTGCAGCGGATTAATGATCTTCATCACGAGCTGGAGTCAACTCCACCTGGCTCGTCGCTGACACCTTCTTCTTCTACAAGCTTTCAGCCTTTAACACCCACCCTGCCAACCCTTCCCTGTCGGGTCAAGGAGGAACTGTATCCTGGCACCTTGCCAAGCCCTAAAAACCAAGCTGCAAAGGTTGAGGTTAGAGTAAGGGAAGGGAGAACTGTCAACATTCATATGTTCTGCACCCGCCGACCAGGTCTTTTGCTTTCTACCATGAAGGCTTTGGATAACCTCGGATTGGATGTACAGCAGGCTGTTATTAGCTGTTTTAATGGCTTTGCTTTAGATGTGTTCAAAGCTGAGCAATGCAGAGAAGGCCAGGATGTCCTCCCTGAGCAAATTAAAGCGGTGCTCTCGGATTCTGCTGGCTTCCATGGTATGATGTGA
Predicted protein sequences of Glyma19g27483
>Glyma19g27483.1   sequence type=predicted peptide   gene model=Glyma19g27483   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNMERYTLPAPPNIIPEEEENIAIAMGAPLIPSFKSMLQQHPQQLDSYFNSSISSTTIPFVPNMDSFLSLDPFSPSFFNNSSSSSNMALDPGFDLGLDTGLHSSAPAPHLFSQAQMMGFEFSELEALAGPGNVNVPFADGAKAAALLRSPHFEPPQQQPTLYRKRRGTAAEIPGLEMVRRKGRKWQEGGGEGEEGSSADVGGSGLNYESDEQNESNGLKLSENGGDNKGKKKGLPAKNLMAERRRRKKLNDRLYMLRSVVPKISKMDRASILGDAIDYLKELLQRINDLHHELESTPPGSSLTPSSSTSFQPLTPTLPTLPCRVKEELYPGTLPSPKNQAAKVEVRVREGRTVNIHMFCTRRPGLLLSTMKALDNLGLDVQQAVISCFNGFALDVFKAEQCREGQDVLPEQIKAVLSDSAGFHGMM*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo