SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g25036): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g25036): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma19g25036

Feature Type:gene_model
Chromosome:Gm19
Start:30900689
stop:30911063
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G40840AT Annotation by Michelle Graham. TAIR10: Rad21/Rec8-like family protein | chr5:16359611-16363722 REVERSE LENGTH=810 SoyBaseE_val: 3.00E-28ISS
GO:0000724GO-bp Annotation by Michelle Graham. GO Biological Process: double-strand break repair via homologous recombination SoyBaseN/AISS
GO:0000911GO-bp Annotation by Michelle Graham. GO Biological Process: cytokinesis by cell plate formation SoyBaseN/AISS
GO:0006261GO-bp Annotation by Michelle Graham. GO Biological Process: DNA-dependent DNA replication SoyBaseN/AISS
GO:0006275GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of DNA replication SoyBaseN/AISS
GO:0006302GO-bp Annotation by Michelle Graham. GO Biological Process: double-strand break repair SoyBaseN/AISS
GO:0006306GO-bp Annotation by Michelle Graham. GO Biological Process: DNA methylation SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007129GO-bp Annotation by Michelle Graham. GO Biological Process: synapsis SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0009555GO-bp Annotation by Michelle Graham. GO Biological Process: pollen development SoyBaseN/AISS
GO:0009560GO-bp Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation SoyBaseN/AISS
GO:0010212GO-bp Annotation by Michelle Graham. GO Biological Process: response to ionizing radiation SoyBaseN/AISS
GO:0010332GO-bp Annotation by Michelle Graham. GO Biological Process: response to gamma radiation SoyBaseN/AISS
GO:0010564GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle process SoyBaseN/AISS
GO:0016444GO-bp Annotation by Michelle Graham. GO Biological Process: somatic cell DNA recombination SoyBaseN/AISS
GO:0022402GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle process SoyBaseN/AISS
GO:0031047GO-bp Annotation by Michelle Graham. GO Biological Process: gene silencing by RNA SoyBaseN/AISS
GO:0043687GO-bp Annotation by Michelle Graham. GO Biological Process: post-translational protein modification SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0051322GO-bp Annotation by Michelle Graham. GO Biological Process: anaphase SoyBaseN/AISS
GO:0051726GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle SoyBaseN/AISS
GO:0000228GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nuclear chromosome SoyBaseN/AISS
GO:0000798GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nuclear cohesin complex SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
KOG1213 KOG Sister chromatid cohesion complex Cohesin, subunit RAD21/SCC1 JGI ISS
PTHR12585Panther SCC1 / RAD21 FAMILY MEMBER JGI ISS
PTHR12585:SF5Panther COHESIN SUBUNIT RAD21 JGI ISS
PF04824PFAM Conserved region of Rad21 / Rec8 like protein JGI ISS
PF04825PFAM N terminus of Rad21 / Rec8 like protein JGI ISS
UniRef100_G7L499UniRef Annotation by Michelle Graham. Most informative UniRef hit: Double-strand-break repair protein rad21-like protein n=1 Tax=Medicago truncatula RepID=G7L499_MEDTR SoyBaseE_val: 4.00E-46ISS
UniRef100_UPI000233E2EDUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233E2ED related cluster n=1 Tax=unknown RepID=UPI000233E2ED SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g25036 not represented in the dataset

Glyma19g25036 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma16g06471 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g087000 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma19g25036.1   sequence type=CDS   gene model=Glyma19g25036   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTAAGGCCAATCTCTCTCGGTTGAGAAGTGACCCTGTAAGGATTGCTGCTTTCTGCTTCAAGAACCTGAAGAGAACTGAGGTCCTTGATACTGACATTTCTTCAGCTGTTGACAAGATTTTGCAAGAAATGGATGTTGTATCCTATAGAGTGCTTGGCTATCTTCTTGTTGGCATTATAAGAATATTCTCTAAAAAGGTTGAATATGTGCTTGAGGATTGCAATGAGGTTCTCATTAAAATCAATAAATTTGTGGTCAACAAAGAAGGCATTGTCCGTGTGGAAACCTTGCGCATGCCTGTTACTATACCAGACAGATTAGAGTTGGATGTTTTTGAGTTAGATGAACTTGAAAATGTTGACAGAGGCCACACTGCTCCTCCGGAGGAAATTACGCTTAGAGACAAAGAAAATGTGTGTAAAACAGAGGGATTTGGGCTGTTTTCTCACGAGAAGTTTGAGGAGTTTGATGTTGCTGAAAATACCAGCTCTTTTGATCAAGATATAGTGGGAAATGCTTTTCTATCTAAACTGTTGAATATGATGGACATCGAAGTTTCTCCACAAAATAGTCCAACTGATTTACTCCTGGAAAGCTGGGATAAATTTCAAAGCAGCATATCTGCCTTTCAAGAAAAGGTTCCGATTGAAGATGAAAGGCTTAGTGTTATTCCACCAAAGTCAAAAAATCTTGATGCAACTCCTCAGTCTAAGTTTCAAGGCGTTGGAAGACCAAAACAAGATTCTGCTACACCAGAGTCAATGCATGTTTCTACACCAGCTGTGAGGGAACAGCCTCCCTTTTCAAGGAAAAGAAGAGTTGGCCTTGATAGAATGATTGTCCTGTCTAACAAGGCAGTTATAAAGAACATAAAGAGTGCAAAAGACTTAGTACGTTTCCCTTTCCCAAGAGAATCCCGCCGTACTTTACTTAATGCACACTGTGTGCAGAGACAGAGAGAATCTCCAATTTCCAGTCTTCCTAATAGATTCTACGAGCCTTTGCTTCCTTGTTCTTCCTCTGAGCTTCAACTCCTATTCTCTAAAAAGAAAATGAAATTACCTAATTCCCTTAAGATTGTGGAAACTCCAGGGAATTTAGATGTGCCAGAATCTCCAATTGCTGGCACTCCACTAAGCCCTTCTCAATCCTCAGATTCCCTTGAAATTGAGGAAACTCGAAGGGTGTTAGATGTACCTGAGTCTCAGGCTTCTGGCTTTCCAAAGCATAAAGCAACTGATTCACAGACTCCTCCTTTGAGTCAACATGAAAACATAGAGATAGAATCTCTAGAAACGAATGAAGTGCCTAATTTGATGGATGAGGAAACAAATTCACGTGGAACAAATGAATCAGAATTATTAGCTGGGTGGTCTGGTCGAACCAGGGAAGTTGCAAGTTGTTTGCATCAGAGTTTTCTACATGCAAGAAAACAAAGAGAGGACACCGTAAACTTTTCACAAGTTTTTGGAGGCCGAGCACGGAAAGAATCTGCACTGCTGTTTTATGAAGTACTGGTTTTGAAAACTACAGGCTATGTAGATGTGGAGCAAAACAAAGCTTATGGTGATATTGCAATATCTAGACTCCCTAAATTAGATCAAACTTTTTTATTTGATGGTCTATTAGAATGA

>Glyma19g25036.1   sequence type=predicted peptide   gene model=Glyma19g25036   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSKANLSRLRSDPVRIAAFCFKNLKRTEVLDTDISSAVDKILQEMDVVSYRVLGYLLVGIIRIFSKKVEYVLEDCNEVLIKINKFVVNKEGIVRVETLRMPVTIPDRLELDVFELDELENVDRGHTAPPEEITLRDKENVCKTEGFGLFSHEKFEEFDVAENTSSFDQDIVGNAFLSKLLNMMDIEVSPQNSPTDLLLESWDKFQSSISAFQEKVPIEDERLSVIPPKSKNLDATPQSKFQGVGRPKQDSATPESMHVSTPAVREQPPFSRKRRVGLDRMIVLSNKAVIKNIKSAKDLVRFPFPRESRRTLLNAHCVQRQRESPISSLPNRFYEPLLPCSSSELQLLFSKKKMKLPNSLKIVETPGNLDVPESPIAGTPLSPSQSSDSLEIEETRRVLDVPESQASGFPKHKATDSQTPPLSQHENIEIESLETNEVPNLMDEETNSRGTNESELLAGWSGRTREVASCLHQSFLHARKQREDTVNFSQVFGGRARKESALLFYEVLVLKTTGYVDVEQNKAYGDIAISRLPKLDQTFLFDGLLE*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo