Glyma19g24415 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g24415): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g24415): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma19g24415

Feature Type:	gene_model
Chromosome:	Gm19
Start:	30009836
stop:	30010667
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g24415

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
ATCG01080	AT	Annotation by Michelle Graham. TAIR10: NADH:ubiquinone/plastoquinone oxidoreductase, chain 6 \| chrC:118377-118907 REVERSE LENGTH=176	SoyBase	E_val: 3.00E-53	ISS
GO:0006091	GO-bp	Annotation by Michelle Graham. GO Biological Process: generation of precursor metabolites and energy	SoyBase	N/A	ISS
GO:0006354	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA-dependent transcription, elongation	SoyBase	N/A	ISS
GO:0015979	GO-bp	Annotation by Michelle Graham. GO Biological Process: photosynthesis	SoyBase	N/A	ISS
GO:0019684	GO-bp	Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction	SoyBase	N/A	ISS
GO:0045333	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular respiration	SoyBase	N/A	ISS
GO:0055114	GO-bp	Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0003959	GO-mf	Annotation by Michelle Graham. GO Molecular Function: NADPH dehydrogenase activity	SoyBase	N/A	ISS
GO:0008137	GO-mf	Annotation by Michelle Graham. GO Molecular Function: NADH dehydrogenase (ubiquinone) activity	SoyBase	N/A	ISS
PF00499	PFAM	NADH-ubiquinone/plastoquinone oxidoreductase chain 6	JGI		ISS
UniRef100_Q2PMN5	UniRef	Annotation by Michelle Graham. Best UniRef hit: NAD(P)H-quinone oxidoreductase subunit 6, chloroplastic n=1 Tax=Glycine max RepID=NU6C_SOYBN	SoyBase	E_val: 1.00E-63	ISS
UniRef100_Q2PMN5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: NAD(P)H-quinone oxidoreductase subunit 6, chloroplastic n=1 Tax=Glycine max RepID=NU6C_SOYBN	SoyBase	E_val: 1.00E-63	ISS

Expression Patterns of Glyma19g24415

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g24415 not represented in the dataset	Glyma19g24415 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma19g24415 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g083500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g24415

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g24415

Limit To All Plant Sequences

>Glyma19g24415.1   sequence type=CDS   gene model=Glyma19g24415   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GCATCACAACTACTTATTTATGTGGGCGCTATAAATATTTTAATAATATTTGTTGTGATGTTTATGAATGATTCCAAATATTATCAAGATTTTCGTCTTTGGACTATTGGGGATGGAATTACTTTGATGGTTTGTACAAGTATCTTTGTTTCACTAATAACTACTATTCTAGATACATCATGGCACGGGATTATTTGGACTACAAGACCCAATCAGATTATAGAGCAAGATTTGATAAGTACTGGTCAACAAATTGGAATTCATTTATCAATAGAGTTTTTACTTCCATTTGAACTAATTTCAATAATCCTTTTAGTTGCTTTGATAGTTTAA

Predicted protein sequences of Glyma19g24415

Limit To All Plant Sequences

>Glyma19g24415.1   sequence type=predicted peptide   gene model=Glyma19g24415   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ASQLLIYVGAINILIIFVVMFMNDSKYYQDFRLWTIGDGITLMVCTSIFVSLITTILDTSWHGIIWTTRPNQIIEQDLISTGQQIGIHLSIEFLLPFELISIILLVALIV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain