SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g22820): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g22820): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma19g22820

Feature Type:gene_model
Chromosome:Gm19
Start:28089814
stop:28090855
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G07920AT Annotation by Michelle Graham. TAIR10: diacylglycerol kinase1 | chr5:2525197-2528396 REVERSE LENGTH=728 SoyBaseE_val: 1.00E-88ISS
GO:0007205GO-bp Annotation by Michelle Graham. GO Biological Process: protein kinase C-activating G-protein coupled receptor signaling pathway SoyBaseN/AISS
GO:0035556GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0004143GO-mf Annotation by Michelle Graham. GO Molecular Function: diacylglycerol kinase activity SoyBaseN/AISS
GO:0005509GO-mf Annotation by Michelle Graham. GO Molecular Function: calcium ion binding SoyBaseN/AISS
PTHR11255Panther DIACYLGLYCEROL KINASE JGI ISS
PTHR11255:SF33Panther JGI ISS
PF00781PFAM Diacylglycerol kinase catalytic domain JGI ISS
UniRef100_B9RLR5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Diacylglycerol kinase, theta, putative n=1 Tax=Ricinus communis RepID=B9RLR5_RICCO SoyBaseE_val: 2.00E-95ISS
UniRef100_I1MT53UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MT53_SOYBN SoyBaseE_val: 2.33E-156ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g22820 not represented in the dataset

Glyma19g22820 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma19g22820.1   sequence type=CDS   gene model=Glyma19g22820   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
AGAAGCTCTAACAGAATTACTGGTGAATATGGGAATAGTGAGAGCATTGGTGAGGTGTCCACAGAAAGCACTGGTGATTCTCATCAAATACAAAATGATCATCATGAAGTGGGTGAAAAAAGTAGCTCGAATAAGGAGGTTCGACATCAAGATAGTGAAGTAGATAATAAGTTGGATAGAAAACCCACTCTTAGACGCAATTCATTAATCAATCAGAAGGATGAATCCCACTCATTAGGAGTGAAGCAGAAATATGATTTGATTGATTTGCCTCTGGATGCAAGACCATTGTTAGTTTTTATAAACAACAAGAGTGATGCCCAGCGTGGAGACTCAGTTAGAATGTGGCTGAATATCCTTTTATATGCTATTCAGGTGATTGAATTAAGTTCAACACAGGGGCTAGAGATGGGACTTTATTTGTTTAGAATGGTGTCTCACTTCAGAGTTCTTGTATGTGGAGGAGATGGTACTGTTGGTTGGGTTCTGAATGCAATAGACAAGCAAAATTTTGTTTCTCTTCCCCCAGTTGCTATTCTTCCTGCTAGTATAGGAAATGATCTTGCAAGAGTTCTCTCCTGGGGAGGTGACTTGGGTCCAGTGGAGAGGCAAGCGGGTCTTACTACATTTTTGCAACACATAGAATATGCTGTTGTTATGGTTCTTGACCATTGGAAGGTAACAATTAGTAATCCACAAGGAAAGCAACAGCTGCAACCAACAAAGTTTTTGAACAATTATCTT

>Glyma19g22820.1   sequence type=predicted peptide   gene model=Glyma19g22820   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
RSSNRITGEYGNSESIGEVSTESTGDSHQIQNDHHEVGEKSSSNKEVRHQDSEVDNKLDRKPTLRRNSLINQKDESHSLGVKQKYDLIDLPLDARPLLVFINNKSDAQRGDSVRMWLNILLYAIQVIELSSTQGLEMGLYLFRMVSHFRVLVCGGDGTVGWVLNAIDKQNFVSLPPVAILPASIGNDLARVLSWGGDLGPVERQAGLTTFLQHIEYAVVMVLDHWKVTISNPQGKQQLQPTKFLNNYL







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo