Warning : Undefined variable $sxsome in
/var/www/html/include/SeqFeatClass.php on line
665
Warning : Undefined variable $sstart in
/var/www/html/include/SeqFeatClass.php on line
665
Warning : Undefined variable $send in
/var/www/html/include/SeqFeatClass.php on line
665
Warning : get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1018
Warning : get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g22780): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1018
Warning : Trying to access array offset on false in
/var/www/html/include/SeqFeatClass.php on line
1019
Warning : get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1020
Warning : get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g22780): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1020
Warning : Trying to access array offset on false in
/var/www/html/include/SeqFeatClass.php on line
1021
Deprecated : preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in
/var/www/html/include/SeqFeatClass.php on line
1025
Deprecated : preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in
/var/www/html/include/SeqFeatClass.php on line
1031
Report for Sequence Feature Glyma19g22780
Feature Type: gene_model
Chromosome: Gm19
Start: 27910294
stop: 27914666
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma19g22780
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT1G13440 AT
Annotation by Michelle Graham. TAIR10: glyceraldehyde-3-phosphate dehydrogenase C2 | chr1:4608465-4610494 REVERSE LENGTH=338
SoyBase E_val: 0 ISS
GO:0006006 GO-bp
Annotation by Michelle Graham. GO Biological Process: glucose metabolic process
SoyBase N/A ISS
GO:0006094 GO-bp
Annotation by Michelle Graham. GO Biological Process: gluconeogenesis
SoyBase N/A ISS
GO:0006096 GO-bp
Annotation by Michelle Graham. GO Biological Process: glycolysis
SoyBase N/A ISS
GO:0006098 GO-bp
Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt
SoyBase N/A ISS
GO:0006833 GO-bp
Annotation by Michelle Graham. GO Biological Process: water transport
SoyBase N/A ISS
GO:0006972 GO-bp
Annotation by Michelle Graham. GO Biological Process: hyperosmotic response
SoyBase N/A ISS
GO:0006979 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to oxidative stress
SoyBase N/A ISS
GO:0007010 GO-bp
Annotation by Michelle Graham. GO Biological Process: cytoskeleton organization
SoyBase N/A ISS
GO:0007030 GO-bp
Annotation by Michelle Graham. GO Biological Process: Golgi organization
SoyBase N/A ISS
GO:0009266 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus
SoyBase N/A ISS
GO:0009651 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to salt stress
SoyBase N/A ISS
GO:0010498 GO-bp
Annotation by Michelle Graham. GO Biological Process: proteasomal protein catabolic process
SoyBase N/A ISS
GO:0019288 GO-bp
Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway
SoyBase N/A ISS
GO:0019761 GO-bp
Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process
SoyBase N/A ISS
GO:0042742 GO-bp
Annotation by Michelle Graham. GO Biological Process: defense response to bacterium
SoyBase N/A ISS
GO:0046686 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to cadmium ion
SoyBase N/A ISS
GO:0051049 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transport
SoyBase N/A ISS
GO:0055114 GO-bp
Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process
SoyBase N/A ISS
GO:0005618 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cell wall
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0005730 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleolus
SoyBase N/A ISS
GO:0005737 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm
SoyBase N/A ISS
GO:0005739 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion
SoyBase N/A ISS
GO:0005829 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytosol
SoyBase N/A ISS
GO:0005886 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane
SoyBase N/A ISS
GO:0009506 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma
SoyBase N/A ISS
GO:0009507 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast
SoyBase N/A ISS
GO:0016020 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: membrane
SoyBase N/A ISS
GO:0004365 GO-mf
Annotation by Michelle Graham. GO Molecular Function: glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity
SoyBase N/A ISS
GO:0005507 GO-mf
Annotation by Michelle Graham. GO Molecular Function: copper ion binding
SoyBase N/A ISS
GO:0008270 GO-mf
Annotation by Michelle Graham. GO Molecular Function: zinc ion binding
SoyBase N/A ISS
KOG0657
KOG
Glyceraldehyde 3-phosphate dehydrogenase
JGI ISS
PTHR10836 Panther
GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE
JGI ISS
PF00044 PFAM
Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain
JGI ISS
PF02800 PFAM
Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain
JGI ISS
UniRef100_E5G6F3 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Glyceraldehyde-3-phosphate dehydrogenase n=2 Tax=Ananas comosus RepID=E5G6F3_ANACO
SoyBase E_val: 0 ISS
UniRef100_I1N7G7 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N7G7_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma19g22780
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma19g22780
Paralog Evidence Comments
Glyma05g06420 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma19g22780 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.19g078300 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma19g22780
Coding sequences of Glyma19g22780
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma19g22780.1 sequence type=CDS gene model=Glyma19g22780 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGGCCAAAAGATCAAGATTGGCATCAATGGATTTGGAAGGATTGGCCGTTTGGTGGCCAGGGTGGCAATGCAGAACGATGACGTGGAGCTTGTTGCTGTTAATGATCCTTTCATCACAACTGATTACATGACTTACATGTTCAAGTATGATACTGTTCATGGGCAATTCAAAAACTGTGAGATTAAGGTTAAGGACAGTAAAACCCTTCTCTTTGGTAGTAGCTCAGTTACTGTTTTTGGAATCAGGAATCCAGAGGAAATTCCATGGGGTGAGGCTGGAGCTGATTACGTTGTTGAATCCACTGGAGTTTTCACTGATCAAGACAAGGCAGCTGCCCACTTGAAGGGTGGTGCAAAGAAGGTTATTATTTCTGCCCCAAGCAAGGATGCCCCAATGTTTGTTGTTGGTGTCAATGAGAAGGAATATAAGTCTGATATCACTGTCGTTTCTAATGCTAGCTGCACAACTAACTGTCTTGCTCCACTTGCAAAGGTTATACATGACAAATTTGGTATTCTTGAAGGCCTCATGAGCACTGTTCACTCTATGACTGCCACTCAAAAGACTGTTGATGGACCATCAATGAAAGACTGGAGAGGTGGAAGAGCTGCTTCTTGTAACATCATTCCTAGTAGCACTGGAGCTGCTAAGGCTGTTGGTAAGGTGCTGCCATCCCTTAATAATAAGTTGACAGGAATGTCTTTCAGAGTTCCAACTGTAGATGTTTCAGTGGTTGATCTCACTGTCAGACTTGAGAAGGGAGCCAGTTATGATGAGATTAAAGCTGCTATCAAGGAGGCATCGGAGGGAAGTATGAAAGGAATCCTTGGTTACACAGAGGATGATGTTGTGTCTACTGATTTTGTGGGTGACAACAGGTCAAGCATTTTTGATGCAAAGGCTGGAATTTCATTGAACAACAACTTTGTGAAACTTGTCTCTTGGTATGACAATGAGTGGGGCTACAGCACACGTGTGGTTGACTTGATTCGACACATGGCCTCAGTCTAA
Predicted protein sequences of Glyma19g22780
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma19g22780.1 sequence type=predicted peptide gene model=Glyma19g22780 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MGQKIKIGINGFGRIGRLVARVAMQNDDVELVAVNDPFITTDYMTYMFKYDTVHGQFKNCEIKVKDSKTLLFGSSSVTVFGIRNPEEIPWGEAGADYVVESTGVFTDQDKAAAHLKGGAKKVIISAPSKDAPMFVVGVNEKEYKSDITVVSNASCTTNCLAPLAKVIHDKFGILEGLMSTVHSMTATQKTVDGPSMKDWRGGRAASCNIIPSSTGAAKAVGKVLPSLNNKLTGMSFRVPTVDVSVVDLTVRLEKGASYDEIKAAIKEASEGSMKGILGYTEDDVVSTDFVGDNRSSIFDAKAGISLNNNFVKLVSWYDNEWGYSTRVVDLIRHMASV*