SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g10217): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g10217): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma19g10217

Feature Type:gene_model
Chromosome:Gm19
Start:12387332
stop:12390541
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G20190AT Annotation by Michelle Graham. TAIR10: CLIP-associated protein | chr2:8711862-8718813 REVERSE LENGTH=1439 SoyBaseE_val: 1.00E-109ISS
GO:0000271GO-bp Annotation by Michelle Graham. GO Biological Process: polysaccharide biosynthetic process SoyBaseN/AISS
GO:0007026GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of microtubule depolymerization SoyBaseN/AISS
GO:0009825GO-bp Annotation by Michelle Graham. GO Biological Process: multidimensional cell growth SoyBaseN/AISS
GO:0009832GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall biogenesis SoyBaseN/AISS
GO:0009932GO-bp Annotation by Michelle Graham. GO Biological Process: cell tip growth SoyBaseN/AISS
GO:0010817GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hormone levels SoyBaseN/AISS
GO:0016049GO-bp Annotation by Michelle Graham. GO Biological Process: cell growth SoyBaseN/AISS
GO:0030243GO-bp Annotation by Michelle Graham. GO Biological Process: cellulose metabolic process SoyBaseN/AISS
GO:0043481GO-bp Annotation by Michelle Graham. GO Biological Process: anthocyanin accumulation in tissues in response to UV light SoyBaseN/AISS
GO:0043622GO-bp Annotation by Michelle Graham. GO Biological Process: cortical microtubule organization SoyBaseN/AISS
GO:0048767GO-bp Annotation by Michelle Graham. GO Biological Process: root hair elongation SoyBaseN/AISS
GO:0050821GO-bp Annotation by Michelle Graham. GO Biological Process: protein stabilization SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005876GO-cc Annotation by Michelle Graham. GO Cellular Compartment: spindle microtubule SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0005938GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell cortex SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0009524GO-cc Annotation by Michelle Graham. GO Cellular Compartment: phragmoplast SoyBaseN/AISS
GO:0051010GO-mf Annotation by Michelle Graham. GO Molecular Function: microtubule plus-end binding SoyBaseN/AISS
PTHR21567Panther CLASP JGI ISS
PTHR21567:SF15Panther OS04G0507500 PROTEIN JGI ISS
PF12348PFAM CLASP N terminal JGI ISS
UniRef100_G7KZK1UniRef Annotation by Michelle Graham. Most informative UniRef hit: CLIP-associating protein n=1 Tax=Medicago truncatula RepID=G7KZK1_MEDTR SoyBaseE_val: 2.00E-110ISS
UniRef100_I1L8J7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L8J7_SOYBN SoyBaseE_val: 1.00E-126ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g10217 not represented in the dataset

Glyma19g10217 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g060900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma19g10217.1   sequence type=CDS   gene model=Glyma19g10217   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGAAGCGCTCGAGCTCGCACGCGCGAAGGACGCGAAGGAGCGAATGGCGGGCGTGGAGCGCCTCCACAAGGTGCTGGAAGCTTCCAGAAGGAGCCTCAGCTCCAGTGAGGTCACTTCTCTTGTCGATTGCTGCTTGGATCTCTTGAAGGACAACAGCTTCAAGGTCTCGCAGGGCGCGCTCCAGGCTCTCGACTCCGCTGCCGTGCACGCCGGTGACCACTTCAAGCTCCACTTCAACGCGCTAGTCCCTGCCGTCGTCGACCGCCTCGGTGATGCCAAGCAGCCCGTCCGCGACGCTGCCAGGCGGTTCCTTCTCACTCTCATGGAGGTTTCATCTCCTACAATAATTGTTGAAAGAGCAGGGTTCTTTGCCTGGACAAGCAAAAGCTGGAGAGTCAGAGAGAAATTTGCACGAACAGTCACATCTGTAATTGGTCTGTTTTCATCTACTGAGCTTCCCCTTCAACGTGCTATTCTTTCTCCTATTTTGCAGTTGCTGAATGATCTGAATCCTGCTGTTAGGGAAGCAACTATTTTGTGTATTGAGGTGAAAGCTATTAATGCTAGGCTAGAGGGAATTCAACCAAAAGTTTGCTCTTCAAATGGTATTTCTAGCAGTTATAATGCTAGGGAAATTAAGCTTGTGGCTGTTAATCCCAAGAAAAGTAGTCCAAAGCATAAAAGTTCATCAAAGGAGACCTTTCTTTTTGGA

>Glyma19g10217.1   sequence type=predicted peptide   gene model=Glyma19g10217   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEEALELARAKDAKERMAGVERLHKVLEASRRSLSSSEVTSLVDCCLDLLKDNSFKVSQGALQALDSAAVHAGDHFKLHFNALVPAVVDRLGDAKQPVRDAARRFLLTLMEVSSPTIIVERAGFFAWTSKSWRVREKFARTVTSVIGLFSSTELPLQRAILSPILQLLNDLNPAVREATILCIEVKAINARLEGIQPKVCSSNGISSSYNAREIKLVAVNPKKSSPKHKSSSKETFLFG







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo