SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma19g08260

Feature Type:gene_model
Chromosome:Gm19
Start:9764408
stop:9766318
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G27750AT Annotation by Michelle Graham. TAIR10: binding | chr4:13841708-13843501 FORWARD LENGTH=305 SoyBaseE_val: 1.00E-34ISS
GO:0006109GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of carbohydrate metabolic process SoyBaseN/AISS
GO:0009745GO-bp Annotation by Michelle Graham. GO Biological Process: sucrose mediated signaling SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
PF08045PFAM Cell division control protein 14, SIN component JGI ISS
UniRef100_I1LJ32UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LJ32_SOYBN SoyBaseE_val: 3.00E-35ISS
UniRef100_Q84J43UniRef Annotation by Michelle Graham. Most informative UniRef hit: Impaired sucrose induction 1 n=1 Tax=Arabidopsis thaliana RepID=Q84J43_ARATH SoyBaseE_val: 7.00E-32ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g056000 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma19g08260.1   sequence type=CDS   gene model=Glyma19g08260   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCATTTACACTACTAGAAAAGTGTGATTCAACATCGTTAAATTTAAGTCGCGTTAACGACGAGAAAATCACAGTTCTCCTTGAAATCTTCTATGAAACACGCGCTTTTCAAGAGCGAGTTGAACCGATTGTTGCTACCAGATCTGATGATGCTGAAGTTGAACTCGCTCTTAGAGTCTTGGAAGGGTGTTTTTTGCTTCACCCTCAAAGTACTGCTCTCGCCCATCAACACAACGCTATTCAAGTTTTAATGAATATATTATCCACTCGTGGAGTGCTTGAGCAAGGTGCATGCTTAGATGCTCTAATCTCATTGATTGTGGATTCATCATCCAATCAAATGGGTTGGGGTCGCTGTTCACAACCTTGGGCAGTTTTACCTTGGACAACGGAATCCTATTTGTTACACATAACTCTTATTTGTTTTATGATACTTATTTTGTTTTCTATTTACAAACTGCTTCATCTTTAG

>Glyma19g08260.1   sequence type=predicted peptide   gene model=Glyma19g08260   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAFTLLEKCDSTSLNLSRVNDEKITVLLEIFYETRAFQERVEPIVATRSDDAEVELALRVLEGCFLLHPQSTALAHQHNAIQVLMNILSTRGVLEQGACLDALISLIVDSSSNQMGWGRCSQPWAVLPWTTESYLLHITLICFMILILFSIYKLLHL*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo