Glyma19g08260 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g08260

Feature Type:	gene_model
Chromosome:	Gm19
Start:	9764408
stop:	9766318
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g08260

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G27750	AT	Annotation by Michelle Graham. TAIR10: binding \| chr4:13841708-13843501 FORWARD LENGTH=305	SoyBase	E_val: 1.00E-34	ISS
GO:0006109	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of carbohydrate metabolic process	SoyBase	N/A	ISS
GO:0009745	GO-bp	Annotation by Michelle Graham. GO Biological Process: sucrose mediated signaling	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
PF08045	PFAM	Cell division control protein 14, SIN component	JGI		ISS
UniRef100_I1LJ32	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LJ32_SOYBN	SoyBase	E_val: 3.00E-35	ISS
UniRef100_Q84J43	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Impaired sucrose induction 1 n=1 Tax=Arabidopsis thaliana RepID=Q84J43_ARATH	SoyBase	E_val: 7.00E-32	ISS

Expression Patterns of Glyma19g08260

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma19g08260 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g056000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g08260

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g08260

Limit To All Plant Sequences

>Glyma19g08260.1   sequence type=CDS   gene model=Glyma19g08260   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCATTTACACTACTAGAAAAGTGTGATTCAACATCGTTAAATTTAAGTCGCGTTAACGACGAGAAAATCACAGTTCTCCTTGAAATCTTCTATGAAACACGCGCTTTTCAAGAGCGAGTTGAACCGATTGTTGCTACCAGATCTGATGATGCTGAAGTTGAACTCGCTCTTAGAGTCTTGGAAGGGTGTTTTTTGCTTCACCCTCAAAGTACTGCTCTCGCCCATCAACACAACGCTATTCAAGTTTTAATGAATATATTATCCACTCGTGGAGTGCTTGAGCAAGGTGCATGCTTAGATGCTCTAATCTCATTGATTGTGGATTCATCATCCAATCAAATGGGTTGGGGTCGCTGTTCACAACCTTGGGCAGTTTTACCTTGGACAACGGAATCCTATTTGTTACACATAACTCTTATTTGTTTTATGATACTTATTTTGTTTTCTATTTACAAACTGCTTCATCTTTAG

Predicted protein sequences of Glyma19g08260

Limit To All Plant Sequences

>Glyma19g08260.1   sequence type=predicted peptide   gene model=Glyma19g08260   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAFTLLEKCDSTSLNLSRVNDEKITVLLEIFYETRAFQERVEPIVATRSDDAEVELALRVLEGCFLLHPQSTALAHQHNAIQVLMNILSTRGVLEQGACLDALISLIVDSSSNQMGWGRCSQPWAVLPWTTESYLLHITLICFMILILFSIYKLLHL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain