SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g06815): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g06815): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma19g06815

Feature Type:gene_model
Chromosome:Gm19
Start:7948828
stop:7953262
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G12780AT Annotation by Michelle Graham. TAIR10: phosphoglycerate kinase 1 | chr3:4061127-4063140 REVERSE LENGTH=481 SoyBaseE_val: 1.00E-32ISS
GO:0000023GO-bp Annotation by Michelle Graham. GO Biological Process: maltose metabolic process SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009658GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast organization SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009744GO-bp Annotation by Michelle Graham. GO Biological Process: response to sucrose stimulus SoyBaseN/AISS
GO:0009749GO-bp Annotation by Michelle Graham. GO Biological Process: response to glucose stimulus SoyBaseN/AISS
GO:0009814GO-bp Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0018119GO-bp Annotation by Michelle Graham. GO Biological Process: peptidyl-cysteine S-nitrosylation SoyBaseN/AISS
GO:0019252GO-bp Annotation by Michelle Graham. GO Biological Process: starch biosynthetic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0019684GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction SoyBaseN/AISS
GO:0019760GO-bp Annotation by Michelle Graham. GO Biological Process: glucosinolate metabolic process SoyBaseN/AISS
GO:0019761GO-bp Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process SoyBaseN/AISS
GO:0030003GO-bp Annotation by Michelle Graham. GO Biological Process: cellular cation homeostasis SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0042744GO-bp Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide catabolic process SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:0070838GO-bp Annotation by Michelle Graham. GO Biological Process: divalent metal ion transport SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0010319GO-cc Annotation by Michelle Graham. GO Cellular Compartment: stromule SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0004618GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphoglycerate kinase activity SoyBaseN/AISS
KOG1367 KOG 3-phosphoglycerate kinase JGI ISS
PTHR23417Panther 3-DEOXY-D-MANNO-OCTULOSONIC-ACID TRANSFERASE/TRNA (GUANINE-N(7)-)-METHYLTRANSFERASE JGI ISS
PTHR23417:SF1Panther TRNA (GUANINE-N(7)-)-METHYLTRANSFERASE JGI ISS
PF00162PFAM Phosphoglycerate kinase JGI ISS
PF02390PFAM Putative methyltransferase JGI ISS
UniRef100_D7TQP9UniRef Annotation by Michelle Graham. Best UniRef hit: Phosphoglycerate kinase n=1 Tax=Vitis vinifera RepID=D7TQP9_VITVI SoyBaseE_val: 0ISS
UniRef100_D7TQP9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Phosphoglycerate kinase n=1 Tax=Vitis vinifera RepID=D7TQP9_VITVI SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g06815 not represented in the dataset

Glyma19g06815 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma13g07735 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g049700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma19g06815.1   sequence type=CDS   gene model=Glyma19g06815   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAATGGCCTTGAGAAAGAGAATATCCATCTTCTTGAGAATCTTTCTAATATCAAAGAGGAAGTTGCTAACTGTGTGGAGTTTGCTAGAGTATTATCGTCAGGAGTTGACATCTTTGTCAATTACTCCTTCTCCAACTCTCATAAAGTTCTAGCATCTACTGTTGGTGTCACCCGTTTCTGGTATGCCTGTATCGCTGGTTTTTACTTTGAGGAGAGGCTTTGTCTACTGAAGAATCTTGCAGAGGCAAGCAGGAAGCCATATGTAGCAATTATTGGAGGTGGTAATCTCTATGATAAAGCAGCTTCCTTTCAGTTTTTAGCTTCCAGATGTCAATGGTTTGTATTTGTGGGAATGATGCCATTTCAAGTAATGCATGCATTAGGAGTATCTGTTCCTCGTAATTTAGTGGACCATAAGGCATTTAATGAAGCTCTAGATACAGTGCGACTTACTCGAGATAGAAACATGCAGATTCTGTATCCAAAAGATTTTTGGTGCAGAAAAAAATGTGATCCAAAGCAATTGCAAGTATTTCCTTCTCATGGAATTTTGGATGTAAATAAAGTGCCTGTTGACCTTGGACCTGTCTCATTGGATGAAATTTGTTCTATGCTTGCAAATTGTAAGAAAATAATTTGGATTGGTCCTGTGAAATTTGCTGATTCAAGTAAATACACCAATGAGGCATCTAAATTGACAAGAATACTTGAACAACTAAGCCAGAACAACTGTGAAATAGCAGTTGTTGGGACTATGGCAAGCAAACTGGTGAGACAGGAAAAAAGTTCACTGTCCTTAATAAATATAGTTGAGAATGCTTCAGTTGTATGGGAATTTCTCAAAGGAAGAAAGCTGCCTGGTGTTATGGGAATTTCTCTTTACATTTTGCTGGGATACCCTTTTGAAATCAACTGGAACAGAATTTACTCTGACCCAGCTCAATCTCTGGTTGTTGATATAGGAAGTGGCAATGGGCTTTTTCTTCTTGAAATGGCTAGAAGGGAGCAAGATCTAAACTTCCTTGGTTTGGAGATCAATGAAAAGAATGGGTACTGTATCGCTACTAATGCAACATCAACATTCCATTCTATTGTTTCTTCTTATCCAGGAGAGTTAGTTCTTGTCTCAATACAGTGTCCAAACCCTGATTTCAATAAACCTGAGCATAGATGGAGGATGCTGCAGAGATCTTTAATCGAAGCAGTGGTGGATCTTCTAGCACCTAATGGGAAGATCTTTCTGCAATCCGATGTAGAAGCCGTGGCAATAAGAATGAAAGAACAATTTTTGACATATGGCAAGGGTAAGCTTGATATGGAGCATGGCCAAAGTGAGTGGCTTGAGGAAAACCCATTTGGACTTGATCAGATTGGGAAAGGCATGTTTTAG

>Glyma19g06815.1   sequence type=predicted peptide   gene model=Glyma19g06815   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNGLEKENIHLLENLSNIKEEVANCVEFARVLSSGVDIFVNYSFSNSHKVLASTVGVTRFWYACIAGFYFEERLCLLKNLAEASRKPYVAIIGGGNLYDKAASFQFLASRCQWFVFVGMMPFQVMHALGVSVPRNLVDHKAFNEALDTVRLTRDRNMQILYPKDFWCRKKCDPKQLQVFPSHGILDVNKVPVDLGPVSLDEICSMLANCKKIIWIGPVKFADSSKYTNEASKLTRILEQLSQNNCEIAVVGTMASKLVRQEKSSLSLINIVENASVVWEFLKGRKLPGVMGISLYILLGYPFEINWNRIYSDPAQSLVVDIGSGNGLFLLEMARREQDLNFLGLEINEKNGYCIATNATSTFHSIVSSYPGELVLVSIQCPNPDFNKPEHRWRMLQRSLIEAVVDLLAPNGKIFLQSDVEAVAIRMKEQFLTYGKGKLDMEHGQSEWLEENPFGLDQIGKGMF*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo