Glyma19g06310 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g06310): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g06310): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma19g06310

Feature Type:	gene_model
Chromosome:	Gm19
Start:	7168809
stop:	7168955
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g06310

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G26110	AT	Annotation by Michelle Graham. TAIR10: decapping 5 \| chr1:9024616-9027556 REVERSE LENGTH=611	SoyBase	E_val: 3.00E-15	ISS
GO:0006486	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein glycosylation	SoyBase	N/A	ISS
GO:0006487	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein N-linked glycosylation	SoyBase	N/A	ISS
GO:0010606	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of cytoplasmic mRNA processing body assembly	SoyBase	N/A	ISS
GO:0017148	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of translation	SoyBase	N/A	ISS
GO:0031087	GO-bp	Annotation by Michelle Graham. GO Biological Process: deadenylation-independent decapping of nuclear-transcribed mRNA	SoyBase	N/A	ISS
GO:0033962	GO-bp	Annotation by Michelle Graham. GO Biological Process: cytoplasmic mRNA processing body assembly	SoyBase	N/A	ISS
GO:0000932	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasmic mRNA processing body	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0042803	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein homodimerization activity	SoyBase	N/A	ISS
PTHR13586	Panther	UNCHARACTERIZED	JGI		ISS
UniRef100_B9HIX6	UniRef	Annotation by Michelle Graham. Best UniRef hit: Predicted protein n=1 Tax=Populus trichocarpa RepID=B9HIX6_POPTR	SoyBase	E_val: 1.00E-14	ISS
UniRef100_B9SEH0	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Protein binding protein, putative n=1 Tax=Ricinus communis RepID=B9SEH0_RICCO	SoyBase	E_val: 5.00E-13	ISS

Expression Patterns of Glyma19g06310

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g06310 not represented in the dataset	Glyma19g06310 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma19g06310 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g046400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g06310

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g06310

Limit To All Plant Sequences

>Glyma19g06310.1   sequence type=CDS   gene model=Glyma19g06310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGTCCGAGAGTGCTTCTCGATTGACTTCCATGGCTGATTCGTACATTGGGAGCTTGATAAGCTTGACCTCTAAGAGTGAGATCAAATACAAAGGTATTCTCTACCACATCAACACTGAAGAGTCCAATATTGGCCTCAAAAAT

Predicted protein sequences of Glyma19g06310

Limit To All Plant Sequences

>Glyma19g06310.1   sequence type=predicted peptide   gene model=Glyma19g06310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASESASRLTSMADSYIGSLISLTSKSEIKYKGILYHINTEESNIGLKN

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain