SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g06310

Feature Type:gene_model
Chromosome:Gm19
Start:7168809
stop:7168955
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g06310
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G26110AT Annotation by Michelle Graham. TAIR10: decapping 5 | chr1:9024616-9027556 REVERSE LENGTH=611 SoyBaseE_val: 3.00E-15ISS
GO:0006486GO-bp Annotation by Michelle Graham. GO Biological Process: protein glycosylation SoyBaseN/AISS
GO:0006487GO-bp Annotation by Michelle Graham. GO Biological Process: protein N-linked glycosylation SoyBaseN/AISS
GO:0010606GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of cytoplasmic mRNA processing body assembly SoyBaseN/AISS
GO:0017148GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of translation SoyBaseN/AISS
GO:0031087GO-bp Annotation by Michelle Graham. GO Biological Process: deadenylation-independent decapping of nuclear-transcribed mRNA SoyBaseN/AISS
GO:0033962GO-bp Annotation by Michelle Graham. GO Biological Process: cytoplasmic mRNA processing body assembly SoyBaseN/AISS
GO:0000932GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasmic mRNA processing body SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0042803GO-mf Annotation by Michelle Graham. GO Molecular Function: protein homodimerization activity SoyBaseN/AISS
PTHR13586Panther UNCHARACTERIZED JGI ISS
UniRef100_B9HIX6UniRef Annotation by Michelle Graham. Best UniRef hit: Predicted protein n=1 Tax=Populus trichocarpa RepID=B9HIX6_POPTR SoyBaseE_val: 1.00E-14ISS
UniRef100_B9SEH0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Protein binding protein, putative n=1 Tax=Ricinus communis RepID=B9SEH0_RICCO SoyBaseE_val: 5.00E-13ISS

Expression Patterns of Glyma19g06310
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma19g06310 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g046400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma19g06310
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g06310
>Glyma19g06310.1   sequence type=CDS   gene model=Glyma19g06310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGTCCGAGAGTGCTTCTCGATTGACTTCCATGGCTGATTCGTACATTGGGAGCTTGATAAGCTTGACCTCTAAGAGTGAGATCAAATACAAAGGTATTCTCTACCACATCAACACTGAAGAGTCCAATATTGGCCTCAAAAAT
Predicted protein sequences of Glyma19g06310
>Glyma19g06310.1   sequence type=predicted peptide   gene model=Glyma19g06310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASESASRLTSMADSYIGSLISLTSKSEIKYKGILYHINTEESNIGLKN






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo