|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT1G26110 | AT | Annotation by Michelle Graham. TAIR10: decapping 5 | chr1:9024616-9027556 REVERSE LENGTH=611 | SoyBase | E_val: 3.00E-15 | ISS |
| GO:0006486 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein glycosylation | SoyBase | N/A | ISS |
| GO:0006487 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein N-linked glycosylation | SoyBase | N/A | ISS |
| GO:0010606 | GO-bp | Annotation by Michelle Graham. GO Biological Process: positive regulation of cytoplasmic mRNA processing body assembly | SoyBase | N/A | ISS |
| GO:0017148 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of translation | SoyBase | N/A | ISS |
| GO:0031087 | GO-bp | Annotation by Michelle Graham. GO Biological Process: deadenylation-independent decapping of nuclear-transcribed mRNA | SoyBase | N/A | ISS |
| GO:0033962 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cytoplasmic mRNA processing body assembly | SoyBase | N/A | ISS |
| GO:0000932 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytoplasmic mRNA processing body | SoyBase | N/A | ISS |
| GO:0005829 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytosol | SoyBase | N/A | ISS |
| GO:0005515 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein binding | SoyBase | N/A | ISS |
| GO:0042803 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein homodimerization activity | SoyBase | N/A | ISS |
| PTHR13586 | Panther | UNCHARACTERIZED | JGI | ISS | |
| UniRef100_B9HIX6 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Predicted protein n=1 Tax=Populus trichocarpa RepID=B9HIX6_POPTR | SoyBase | E_val: 1.00E-14 | ISS |
| UniRef100_B9SEH0 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Protein binding protein, putative n=1 Tax=Ricinus communis RepID=B9SEH0_RICCO | SoyBase | E_val: 5.00E-13 | ISS |
|
Glyma19g06310 not represented in the dataset |
Glyma19g06310 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.19g046400 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma19g06310.1 sequence type=CDS gene model=Glyma19g06310 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGCGTCCGAGAGTGCTTCTCGATTGACTTCCATGGCTGATTCGTACATTGGGAGCTTGATAAGCTTGACCTCTAAGAGTGAGATCAAATACAAAGGTATTCTCTACCACATCAACACTGAAGAGTCCAATATTGGCCTCAAAAAT
>Glyma19g06310.1 sequence type=predicted peptide gene model=Glyma19g06310 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MASESASRLTSMADSYIGSLISLTSKSEIKYKGILYHINTEESNIGLKN
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||