SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g04948): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g04948): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma19g04948

Feature Type:gene_model
Chromosome:Gm19
Start:5192242
stop:5194241
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g04948
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G15680AT Annotation by Michelle Graham. TAIR10: ARM repeat superfamily protein | chr5:5101188-5110793 REVERSE LENGTH=2153 SoyBaseE_val: 6.00E-84ISS
GO:0006487GO-bp Annotation by Michelle Graham. GO Biological Process: protein N-linked glycosylation SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
PTHR12295Panther CELL POLARITY PROTEIN JGI ISS
PTHR12295:SF2Panther gb def: Hypothetical protein F14F8 60 JGI ISS
UniRef100_F4KB73UniRef Annotation by Michelle Graham. Most informative UniRef hit: Armadillo/beta-catenin-like repeat-containing protein n=1 Tax=Arabidopsis thaliana RepID=F4KB73_ARATH SoyBaseE_val: 3.00E-81ISS
UniRef100_I1LHK2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LHK2_SOYBN SoyBaseE_val: 1.00E-83ISS

Expression Patterns of Glyma19g04948
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g04948 not represented in the dataset
Glyma19g04948 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma19g04948 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma19g04948
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g04948
>Glyma19g04948.1   sequence type=CDS   gene model=Glyma19g04948   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGGCAGGGAGTGCTGCCAAGTTGATCGTCGACGCTCTGCTTCAGCGCTTCCTCCCTCTCGCACGGCGTCGTATCGAAACCGCGCAAGCTCAGGATGGGCAATACCTGCGACCATCTGATCCGGCCTACGAGCAAGTCCTAGATTCGCTTGCAATGGTGGCGCGCCACACTCCTGTTCCGCTGCTGGAAGCCTTATTAAGATGGAGAGAGAGTGAATCTCCGAAGGGTGCAAATGATGCATCAACGTTCCAAAGGAAGCTTGCGGTGGAGTGCATTTTTTGCTCAGCGTGTATCCGCTTTGTAGAGTGTTGTCCGCAAGAGGGGCTTACTGAGAAGCTGTGGTCTGGGCTTGAAAATTTTGTTTTCGACTGGTTAATAAATGCTGACAGGTAA
Predicted protein sequences of Glyma19g04948
>Glyma19g04948.1   sequence type=predicted peptide   gene model=Glyma19g04948   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKAGSAAKLIVDALLQRFLPLARRRIETAQAQDGQYLRPSDPAYEQVLDSLAMVARHTPVPLLEALLRWRESESPKGANDASTFQRKLAVECIFCSACIRFVECCPQEGLTEKLWSGLENFVFDWLINADR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo