Glyma19g04280 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g04280

Feature Type:	gene_model
Chromosome:	Gm19
Start:	4398093
stop:	4406829
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g04280

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G24530	AT	Annotation by Michelle Graham. TAIR10: 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein \| chr5:8378964-8383154 FORWARD LENGTH=341	SoyBase	E_val: 9.00E-79	ISS
GO:0000165	GO-bp	Annotation by Michelle Graham. GO Biological Process: MAPK cascade	SoyBase	N/A	ISS
GO:0001666	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to hypoxia	SoyBase	N/A	ISS
GO:0006612	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane	SoyBase	N/A	ISS
GO:0009595	GO-bp	Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus	SoyBase	N/A	ISS
GO:0009617	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to bacterium	SoyBase	N/A	ISS
GO:0009620	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to fungus	SoyBase	N/A	ISS
GO:0009627	GO-bp	Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance	SoyBase	N/A	ISS
GO:0009697	GO-bp	Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process	SoyBase	N/A	ISS
GO:0009813	GO-bp	Annotation by Michelle Graham. GO Biological Process: flavonoid biosynthetic process	SoyBase	N/A	ISS
GO:0009862	GO-bp	Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009867	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0010200	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to chitin	SoyBase	N/A	ISS
GO:0010310	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process	SoyBase	N/A	ISS
GO:0010363	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response	SoyBase	N/A	ISS
GO:0031347	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of defense response	SoyBase	N/A	ISS
GO:0031348	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response	SoyBase	N/A	ISS
GO:0034976	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to endoplasmic reticulum stress	SoyBase	N/A	ISS
GO:0042742	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to bacterium	SoyBase	N/A	ISS
GO:0043900	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process	SoyBase	N/A	ISS
GO:0045087	GO-bp	Annotation by Michelle Graham. GO Biological Process: innate immune response	SoyBase	N/A	ISS
GO:0050832	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to fungus	SoyBase	N/A	ISS
GO:0055114	GO-bp	Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0016491	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity	SoyBase	N/A	ISS
GO:0016706	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors	SoyBase	N/A	ISS
KOG0143	KOG	Iron/ascorbate family oxidoreductases	JGI		ISS
PTHR10209	Panther	FE(II)/ ASCORBATE OXIDASE SUPERFAMILY	JGI		ISS
PTHR10209:SF55	Panther	OXIDOREDUCTASE, 2OG-FE(II) OXYGENASE FAMILY PROTEI	JGI		ISS
PF03171	PFAM	2OG-Fe(II) oxygenase superfamily	JGI		ISS
UniRef100_B9T297	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: 1-aminocyclopropane-1-carboxylate oxidase, putative n=1 Tax=Ricinus communis RepID=B9T297_RICCO	SoyBase	E_val: 1.00E-112	ISS
UniRef100_UPI000233E1AF	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233E1AF related cluster n=1 Tax=unknown RepID=UPI000233E1AF	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma19g04280

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g04280

Paralog	Evidence	Comments
Glyma13g06715	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g04280 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g034000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g04280

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g04280

Limit To All Plant Sequences

>Glyma19g04280.1   sequence type=CDS   gene model=Glyma19g04280   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGACCTTGGATCAGATGCTTGTGTCTAGTTGGTACAATGTTCATTCCTCGGTGCCCCCATCCTTTGTGCAATTACCAGAAAACAGGCCTGGCAGGGTGGTTAGTTCTTTGCATAAGGCAATACCGGTGATTGATTTTGGAGGACATGACCTTGGTGATACCACAAAACAAGTTTTGGAAGCCTCCGAGGAATATGGCTTTTTCCAGGTTATCAACCATGGAGTTTCCAAGGATTTAATGGACGAAACAATGAACATTTTTAAAGAATTCCATGCCATGCCTCCCAAAGAGAAGGTAAATGAATGCTCCAAGGACCCAAATGGAAGCTGCAAGCTTTATACAAGTAGTGAGAATTACAAGAAAGATGCGATTCATTATTGGAAGGACTCACTAACACATCCTTGTCCTCCTTCTGGGGAATACATGGAGTATTGGCCACAAAAACCATCCAAATACCGAGATGTTGTTGGAAAATACACAAGAGAATTGAAGAAACTAGCCCTTAAAATTTTGGAGCTGCTTTGTGAAGGGTTAGGGCTAAACCTAGGATATTTCTGTGGTGGACTAAGTGAAAATCCATCAGTGTTGGTTCATCACTACCCTCCTTGCCCTGACCCAAGTTTAACACTAGGCTTAGCTAAGCACAGGGACCCTACCATTATCACCATTTTGCTTCAAGATAAGGAGGTTCAAGGACTTCAAGTCCTGAAGGATGGAGAATGGATTGGAGTTGAGCCTATTCCCAACGCTTTTGTGGTTAACATTGGTCTACTCTTGCAGATCATAACTAATGGAAGGCTTGTTGGTGCTGAACACCGAGCTGTGACGAATTCGAGCAGTGCACGCACAAGTGTTGCCTATTTCGTCTATCCATCATTTGAAAGCATCATAGAACCTGCACAAGCTTTGATCAATGAAAGCACTCCAGCAATATACAAATCCATGACATTCGGAGAGTTTCGTAGAAATTTCTTTCAAAAGGGTCCCAAGATTGAAGAAGAACTGCAATAG

Predicted protein sequences of Glyma19g04280

Limit To All Plant Sequences

>Glyma19g04280.1   sequence type=predicted peptide   gene model=Glyma19g04280   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
METLDQMLVSSWYNVHSSVPPSFVQLPENRPGRVVSSLHKAIPVIDFGGHDLGDTTKQVLEASEEYGFFQVINHGVSKDLMDETMNIFKEFHAMPPKEKVNECSKDPNGSCKLYTSSENYKKDAIHYWKDSLTHPCPPSGEYMEYWPQKPSKYRDVVGKYTRELKKLALKILELLCEGLGLNLGYFCGGLSENPSVLVHHYPPCPDPSLTLGLAKHRDPTIITILLQDKEVQGLQVLKDGEWIGVEPIPNAFVVNIGLLLQIITNGRLVGAEHRAVTNSSSARTSVAYFVYPSFESIIEPAQALINESTPAIYKSMTFGEFRRNFFQKGPKIEEELQ*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain