Glyma19g04015 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g04015

Feature Type:	gene_model
Chromosome:	Gm19
Start:	4109544
stop:	4110771
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g04015

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
UniRef100_UPI000233E1B0	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233E1B0 related cluster n=1 Tax=unknown RepID=UPI000233E1B0	SoyBase	E_val: 2.00E-68	ISS

Expression Patterns of Glyma19g04015

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g04015 not represented in the dataset	Glyma19g04015 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g04015

Paralog	Evidence	Comments
Glyma13g06450	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g04015 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g032500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g04015

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g04015

Limit To All Plant Sequences

>Glyma19g04015.1   sequence type=CDS   gene model=Glyma19g04015   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAACAAGGGTCTCTCCTTTGTGCTGCTGATTCTTCTGATCCACTACAACAACGTTGTCAACGCCAACAACAAAAACTGTGTCACAGAGGATTGCCTCATCGGCAACAATGATTTGGAATCAGAATTCTACTTCGGTTCCCATGTGGCCAGAATGCTCTACGATGTGAGCCAATCTGTGTCTGGCCAAACAGGCAATTCAAACAACAAAGCTGTTAATTGTCCACAAAGCAATGGCTACCGAACCTGCTTGCCTTCCAAAAACGGTGGTGGCCCTAACCAAAGTTGTGGCGATTACACCAGGGTTTGCTAA

Predicted protein sequences of Glyma19g04015

Limit To All Plant Sequences

>Glyma19g04015.1   sequence type=predicted peptide   gene model=Glyma19g04015   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNKGLSFVLLILLIHYNNVVNANNKNCVTEDCLIGNNDLESEFYFGSHVARMLYDVSQSVSGQTGNSNNKAVNCPQSNGYRTCLPSKNGGGPNQSCGDYTRVC*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain