Glyma19g03900 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g03900

Feature Type:	gene_model
Chromosome:	Gm19
Start:	3949138
stop:	3949943
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g03900

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G12600	AT	Annotation by Michelle Graham. TAIR10: nudix hydrolase homolog 16 \| chr3:4004676-4005995 FORWARD LENGTH=171	SoyBase	E_val: 2.00E-30	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0016787	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydrolase activity	SoyBase	N/A	ISS
PTHR12629	Panther	DIPHOSPHOINOSITOL POLYPHOSPHATE PHOSPHOHYDROLASE	JGI		ISS
PF00293	PFAM	NUDIX domain	JGI		ISS
UniRef100_B9RG80	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Diphosphoinositol polyphosphate phosphohydrolase, putative n=1 Tax=Ricinus communis RepID=B9RG80_RICCO	SoyBase	E_val: 1.00E-43	ISS
UniRef100_I1JW37	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JW37_SOYBN	SoyBase	E_val: 7.00E-49	ISS

Expression Patterns of Glyma19g03900

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma19g03900 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g031500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g03900

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g03900

Limit To All Plant Sequences

>Glyma19g03900.1   sequence type=CDS   gene model=Glyma19g03900   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GGAGGTTGGGAGAATGATGAAACTGTTGAGGAGGCTGCAGTTAGAGAAGCTATTGAAGAAGCAGGAGTTCGAGGAGACCTAATGTGGTATTGCATTGGTTTTGAAGTCATCTATGATGAGTTTGATTTTCTTGGGAACTATGAATTTAGGAGTAAGACCCTCCAAGATGAGTGTAGTCCAGAAGGTTTATGCAAAGCAGCAATGTTTGCATTGTTTGTGAAAGAGGAACTTGAGTCATGGCCTGAGCAAAGCACCAGAAAAAGGAGTTGGCTGGCTGTATCAGAGGCACTAGCAAACTGTTGA

Predicted protein sequences of Glyma19g03900

Limit To All Plant Sequences

>Glyma19g03900.1   sequence type=predicted peptide   gene model=Glyma19g03900   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GGWENDETVEEAAVREAIEEAGVRGDLMWYCIGFEVIYDEFDFLGNYEFRSKTLQDECSPEGLCKAAMFALFVKEELESWPEQSTRKRSWLAVSEALANC*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain