Report for Sequence Feature Glyma19g03570
Feature Type: gene_model
Chromosome: Gm19
Start: 3599652
stop: 3601226
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma19g03570
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G29370 AT
Annotation by Michelle Graham. TAIR10: unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G39240.1); Has 16 Blast hits to 16 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:11278652-11278957 FORWARD LENGTH=101
SoyBase E_val: 2.00E-15 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0005575 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cellular component
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
UniRef100_I1N6B2 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N6B2_SOYBN
SoyBase E_val: 2.00E-89 ISS
Expression Patterns of Glyma19g03570
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma19g03570
Paralog Evidence Comments
Glyma13g06130 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma19g03570 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.19g029200 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma19g03570
Coding sequences of Glyma19g03570
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma19g03570.1 sequence type=CDS gene model=Glyma19g03570 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGACAACAATCACAAAGCACAGTTACAAACTCTCCCTCAAGAGAGCCACAAAGAGAATAACAAGAAGGAGAAGAAGACACCCACAGCACAACCACCCAAAAAGCACCACCACAATTGTGCACAGAAAGTGCAGCAACAACAACAATAATAATAAGCTTTGTGAAAAGCTTGAGGCTTTGAAGAACTTAATCCCCACAACAACAACAACAACAACAACCCACGATGGAGAAGAAGAAGCGGTGAAACCCGACCAGCTGTTCAAGGAAACCGCAGAGTACATCGTGTTGCTGCGGACGCGCGTCGTGGTTCTCCAGAAACTCATTGAGTATTATGGAAACAACAACGACACCACCCAAGATGAGAATGAACATGAAGATGGTGTCTTGTTTACATAG
Predicted protein sequences of Glyma19g03570
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma19g03570.1 sequence type=predicted peptide gene model=Glyma19g03570 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MTTITKHSYKLSLKRATKRITRRRRRHPQHNHPKSTTTIVHRKCSNNNNNNKLCEKLEALKNLIPTTTTTTTTHDGEEEAVKPDQLFKETAEYIVLLRTRVVVLQKLIEYYGNNNDTTQDENEHEDGVLFT*