SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g03180

Feature Type:gene_model
Chromosome:Gm19
Start:3262736
stop:3263864
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g03180
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G11670AT Annotation by Michelle Graham. TAIR10: UDP-Glycosyltransferase superfamily protein | chr3:3681090-3684495 REVERSE LENGTH=808 SoyBaseE_val: 2.00E-122ISS
GO:0001666GO-bp Annotation by Michelle Graham. GO Biological Process: response to hypoxia SoyBaseN/AISS
GO:0006636GO-bp Annotation by Michelle Graham. GO Biological Process: unsaturated fatty acid biosynthetic process SoyBaseN/AISS
GO:0006655GO-bp Annotation by Michelle Graham. GO Biological Process: phosphatidylglycerol biosynthetic process SoyBaseN/AISS
GO:0006869GO-bp Annotation by Michelle Graham. GO Biological Process: lipid transport SoyBaseN/AISS
GO:0009058GO-bp Annotation by Michelle Graham. GO Biological Process: biosynthetic process SoyBaseN/AISS
GO:0015995GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process SoyBaseN/AISS
GO:0016036GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation SoyBaseN/AISS
GO:0016117GO-bp Annotation by Michelle Graham. GO Biological Process: carotenoid biosynthetic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019375GO-bp Annotation by Michelle Graham. GO Biological Process: galactolipid biosynthetic process SoyBaseN/AISS
GO:0042550GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem I stabilization SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009707GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast outer membrane SoyBaseN/AISS
GO:0016757GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring glycosyl groups SoyBaseN/AISS
GO:0035250GO-mf Annotation by Michelle Graham. GO Molecular Function: UDP-galactosyltransferase activity SoyBaseN/AISS
GO:0046480GO-mf Annotation by Michelle Graham. GO Molecular Function: galactolipid galactosyltransferase activity SoyBaseN/AISS
PTHR12526Panther GLYCOSYLTRANSFERASE JGI ISS
PTHR12526:SF202Panther OS11G0158400 PROTEIN JGI ISS
UniRef100_I1JQ87UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JQ87_SOYBN SoyBaseE_val: 5.00E-162ISS
UniRef100_Q6DW76UniRef Annotation by Michelle Graham. Most informative UniRef hit: Digalactosyldiacylglycerol synthase 1, chloroplastic n=1 Tax=Glycine max RepID=DGDG1_SOYBN SoyBaseE_val: 5.00E-159ISS

Expression Patterns of Glyma19g03180
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma19g03180 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma19g03180
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g03180
>Glyma19g03180.1   sequence type=CDS   gene model=Glyma19g03180   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GTTCTTCGTCTCTCTGCTGCTACTCAGGATTTACCAAAGTCTGTAATTTGCAATGTTCATGGTGTGAATCCCGAATTCTTGAAAATTGGAGAAAAGATTGCTGCAGAGAGGGAGCTGGGGCAGAAAGCCTTTACAAAAGGGGCATATTTCCTGGGAAAGATGGTGTGGGGAAAGGGATATAAGGAGTTGATAGATTTATTAGCAAAGCATAAGGCTGACCTTGATGGTTTCAAGTTGGATGTATTTGGAAATGGAGAGGATGCTAATGAAGTTCAGAGTGCAGCCAGAAGGTTGGATTTGAATCTCAACTTTCAGAAAGGAAGAGATCATGCAGACGATTCTCTTCATGGGTACAAAGTCTTTATAAATCCTAGCATTAGCACTTGCCATGGGCAAATTTTAGTTTGTGCTGATCATCCATCAAATGAGTTCTTCAGGTCATTTCCCAACTGTTTGACTTACAGGACATCCAAAGACTTTGTAGCAAAAGTAAAAGAAGCATTGGAAAATGAGCCTTATCCTCTAACACCTGAGCAAAGATATCAACTTTCTTGGGAGGCTGCTACTCAAAGATTTATGGAATATTCCGAGCTTGATAGGATCCTGAACATGGAAAATAATGGTGAAAAGGAAAGTGTAGATAAGGGAAAGCTCATTGCTAAGTCAGCATCAATGCCTAATCTGACAGAACTAGTAGATGGAGGCTTAGCATTTGCTCACTATTGTCTTATTGGGAATTAA
Predicted protein sequences of Glyma19g03180
>Glyma19g03180.1   sequence type=predicted peptide   gene model=Glyma19g03180   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
VLRLSAATQDLPKSVICNVHGVNPEFLKIGEKIAAERELGQKAFTKGAYFLGKMVWGKGYKELIDLLAKHKADLDGFKLDVFGNGEDANEVQSAARRLDLNLNFQKGRDHADDSLHGYKVFINPSISTCHGQILVCADHPSNEFFRSFPNCLTYRTSKDFVAKVKEALENEPYPLTPEQRYQLSWEAATQRFMEYSELDRILNMENNGEKESVDKGKLIAKSASMPNLTELVDGGLAFAHYCLIGN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo