Glyma19g03000 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g03000): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g03000): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma19g03000

Feature Type:	gene_model
Chromosome:	Gm19
Start:	3105011
stop:	3107033
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g03000

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G05680	AT	Annotation by Michelle Graham. TAIR10: Uridine diphosphate glycosyltransferase 74E2 \| chr1:1703196-1704639 REVERSE LENGTH=453	SoyBase	E_val: 1.00E-132	ISS
GO:0008152	GO-bp	Annotation by Michelle Graham. GO Biological Process: metabolic process	SoyBase	N/A	ISS
GO:0009407	GO-bp	Annotation by Michelle Graham. GO Biological Process: toxin catabolic process	SoyBase	N/A	ISS
GO:0010016	GO-bp	Annotation by Michelle Graham. GO Biological Process: shoot morphogenesis	SoyBase	N/A	ISS
GO:0010583	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cyclopentenone	SoyBase	N/A	ISS
GO:0042631	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to water deprivation	SoyBase	N/A	ISS
GO:0070301	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to hydrogen peroxide	SoyBase	N/A	ISS
GO:0071215	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to abscisic acid stimulus	SoyBase	N/A	ISS
GO:0071475	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular hyperosmotic salinity response	SoyBase	N/A	ISS
GO:0080024	GO-bp	Annotation by Michelle Graham. GO Biological Process: indolebutyric acid metabolic process	SoyBase	N/A	ISS
GO:0080167	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to karrikin	SoyBase	N/A	ISS
GO:0005575	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cellular component	SoyBase	N/A	ISS
GO:0008194	GO-mf	Annotation by Michelle Graham. GO Molecular Function: UDP-glycosyltransferase activity	SoyBase	N/A	ISS
GO:0016757	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring glycosyl groups	SoyBase	N/A	ISS
GO:0016758	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring hexosyl groups	SoyBase	N/A	ISS
GO:0035251	GO-mf	Annotation by Michelle Graham. GO Molecular Function: UDP-glucosyltransferase activity	SoyBase	N/A	ISS
GO:0052638	GO-mf	Annotation by Michelle Graham. GO Molecular Function: indole-3-butyrate beta-glucosyltransferase activity	SoyBase	N/A	ISS
KOG1192	KOG	UDP-glucuronosyl and UDP-glucosyl transferase	JGI		ISS
PTHR11926	Panther	GLUCOSYL/GLUCURONOSYL TRANSFERASES	JGI		ISS
PTHR11926:SF15	Panther	UDP-GLUCURONOSYLTRANSFERASE RELATED	JGI		ISS
PF00201	PFAM	UDP-glucoronosyl and UDP-glucosyl transferase	JGI		ISS
UniRef100_G7KSI0	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: UDP-glucose glucosyltransferase n=1 Tax=Medicago truncatula RepID=G7KSI0_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_I1N671	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N671_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma19g03000

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g03000 not represented in the dataset	Glyma19g03000 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g03000

Paralog	Evidence	Comments
Glyma13g05580	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g03000 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g025100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g03000

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g03000

Limit To All Plant Sequences

>Glyma19g03000.2   sequence type=CDS   gene model=Glyma19g03000   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGAAGAAAAGCATAACAAGCAGAGCACATTGTTTAGTGCTAGCATTTCCAGGTCAAGGCCATATCAATCCCATGCTTCAATTCTCCAAGCTATTGGAGCGTCAAGGGGTGAGAATAACACTTGTTACTACTCGTTTCTATTCCAAGAATTTGCAAAACGTGCCTCCTTCCATTGCTCTTGAAACCATTTCTGATGGGTTTGATGAAGTTGGGCCCCAAGAGGCTGGGAGCCCCAAGGCCTATATAGATCGCTTGTGCCAAGTTGGATCAGAAACCTTTCATGAGCTTCTTGAGAAACTTGGCAAATCAAGAAACCATGTTGATTGTGTTATTTATGATTCATTCTTCCCTTGGGCACTAGATGTTACCAAGAGATTTGGGATACTTGGAGCTTCTTATCTCACTCAAAATATGACCGTCAATAATATATACTATCATGTTCACTTGGGAACGTTGCAAGCTCCACTCAAAGAGCATGAGATTTCCCTTCCCAAGTTGCCTAAACTTCAACACGAGGACATGCCTTCTTTTTTCTTCACATATGAAGAAGATCCATCTATGCTTGATTTTTTTGTGGTTCAGTTCTCCAATATCGACAAAGCTGATTGGATCCTATGCAATACATACTATGAGCTGGACAAAGAGATTGTAGATTGGATCATGGAGATTTGGCCAAAATTTAGGTCCATAGGACCAAACATACCATCTTTATTCTTAGATAAGCGATATGAAAATGACCAAGATTATGGGGTCACAGAATTCAAGAGGGATGAATGCATCGAATGGCTAGATGATAAGCCAAAAGGGTCTGTTGTTTATGTATCGTTCGGGAGTATAGCTACCTTTGGTGACGAGCAAATGGAAGAGCTAGCTTGTTGTTTGAAAGAGTCCTTGGGCTACTTTTTGTGGGTGGTTAGAGCCTCTGAAGAGACTAAACTTCCTAAAGGTTTTGAGAAAAAAACAAAGAAAGGCTTGGTAGTGACATGGTGCTCCCAACTAAAAGTTCTTGCTCATGAGGCTATAGGATGCTTTGTGACACATTGTGGTTGGAATTCCACTTTAGAAACTTTATGCTTAGGAGTCCCGATAATTGCAATACCATTTTGGTCAGATCAAAGCACAAATGCAAAGCTTATGGCGGATGTTTGGAAGATCGGAATTAGAGCTCCTATTGACGACAACAAGGTTGTGCGTCGAGAAGCACTAAAGCACTGCATAAGGGAAATAATGGAGAATGAAAAAGGCAAAGAGATGAAAAGTAATGCCATTCGATGGAAGACCTTGGCTGTAAAAGCTGTTAGTGATGATGGTAGTTCTCATAAAAATATTCTAGAATTTACAAATAACTTGTTTCATCCATAA

Predicted protein sequences of Glyma19g03000

Limit To All Plant Sequences

>Glyma19g03000.2   sequence type=predicted peptide   gene model=Glyma19g03000   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEKKSITSRAHCLVLAFPGQGHINPMLQFSKLLERQGVRITLVTTRFYSKNLQNVPPSIALETISDGFDEVGPQEAGSPKAYIDRLCQVGSETFHELLEKLGKSRNHVDCVIYDSFFPWALDVTKRFGILGASYLTQNMTVNNIYYHVHLGTLQAPLKEHEISLPKLPKLQHEDMPSFFFTYEEDPSMLDFFVVQFSNIDKADWILCNTYYELDKEIVDWIMEIWPKFRSIGPNIPSLFLDKRYENDQDYGVTEFKRDECIEWLDDKPKGSVVYVSFGSIATFGDEQMEELACCLKESLGYFLWVVRASEETKLPKGFEKKTKKGLVVTWCSQLKVLAHEAIGCFVTHCGWNSTLETLCLGVPIIAIPFWSDQSTNAKLMADVWKIGIRAPIDDNKVVRREALKHCIREIMENEKGKEMKSNAIRWKTLAVKAVSDDGSSHKNILEFTNNLFHP*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain