SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g02380

Feature Type:gene_model
Chromosome:Gm19
Start:2096979
stop:2100091
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g02380
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G01280AT Annotation by Michelle Graham. TAIR10: voltage dependent anion channel 1 | chr3:85754-87612 FORWARD LENGTH=276 SoyBaseE_val: 5.00E-150ISS
GO:0006511GO-bp Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0006820GO-bp Annotation by Michelle Graham. GO Biological Process: anion transport SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009853GO-bp Annotation by Michelle Graham. GO Biological Process: photorespiration SoyBaseN/AISS
GO:0044070GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of anion transport SoyBaseN/AISS
GO:0051788GO-bp Annotation by Michelle Graham. GO Biological Process: response to misfolded protein SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0080129GO-bp Annotation by Michelle Graham. GO Biological Process: proteasome core complex assembly SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005741GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial outer membrane SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009536GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastid SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0008308GO-mf Annotation by Michelle Graham. GO Molecular Function: voltage-gated anion channel activity SoyBaseN/AISS
KOG3126 KOG Porin/voltage-dependent anion-selective channel protein JGI ISS
PTHR11743Panther VOLTAGE-DEPENDENT ANION-SELECTIVE CHANNEL JGI ISS
PTHR11743:SF14Panther VOLTAGE-DEPENDENT ANION-SELECTIVE CHANNEL-RELATED JGI ISS
PF01459PFAM Eukaryotic porin JGI ISS
UniRef100_I1N628UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N628_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q6W2J4UniRef Annotation by Michelle Graham. Most informative UniRef hit: VDAC1.2 n=2 Tax=Lotus japonicus RepID=Q6W2J4_LOTJA SoyBaseE_val: 0ISS

Expression Patterns of Glyma19g02380
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g02380
ParalogEvidenceComments
Glyma13g05130 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g02380 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g020100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma19g02380
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g02380
>Glyma19g02380.1   sequence type=CDS   gene model=Glyma19g02380   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTAAGGGTCCTGGTCTCTACTCTGACATTGGCAAGAAAGCCAGAGATCTCCTGTTCAAGGACTACCACAGTGACCAGAAGTTTACCATCACTACCTACTCACCCACTGGAGTTGCTATAACATCCTCGGGGACCAAGAAAGGTGACCTTTTTGTGGCGGATGTTAACACCCAGTTGAAGAACAAGAACATCACCACTGATATCAAAGTGGACACCGGTTCCAATCTTTTCACAACTATCACTGTCAATGAGCCTGCTCCTGGTCTCAAGACTATTTTTAGCTTTAGAGTTCCTGATCAAAGGTCTGGAAAGGTGGAAGTCCAGTACTTGCATGACTATGCTGGAATAAGCACCAGTGTGGGTTTAACAGCAAACCCAATTGTCAACTTCTCCGGCGTTGTAGGAACTAATGTACTTGCCCTTGGTACTGATGTTTCTTTTGACACCAAGATTGGGGAGTTAACTAAATTCAATGCTGGATTGAACTTCACCAAAGATGATTTGGTTGCCTCATTGACTGTGAATAACAAAGGTGATTCCCTGAATGCTTCATACTACCATACAGTCAATCGCTTGACCAACACAGCTGTTGGTGCTGAGGTAACTCACCAATTCTCAACCAATGAGAACACCCTCACACTTGGCACCCAGCATGCATTGGATCCATTGACGACTGTGAAGGCTCGTGTCAACAACTTGGGCAAGGCAAATGCTCTCATCCAGCACGAGTGGCGTCCCAGATCGTTCTTCACCATTTCTGGGGAGGTTGACACTAAGGCCATTGAGAAGAGTGCAAAGGTTGGATTAGGTTTGGCCCTCAAACCCTAA
Predicted protein sequences of Glyma19g02380
>Glyma19g02380.1   sequence type=predicted peptide   gene model=Glyma19g02380   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSKGPGLYSDIGKKARDLLFKDYHSDQKFTITTYSPTGVAITSSGTKKGDLFVADVNTQLKNKNITTDIKVDTGSNLFTTITVNEPAPGLKTIFSFRVPDQRSGKVEVQYLHDYAGISTSVGLTANPIVNFSGVVGTNVLALGTDVSFDTKIGELTKFNAGLNFTKDDLVASLTVNNKGDSLNASYYHTVNRLTNTAVGAEVTHQFSTNENTLTLGTQHALDPLTTVKARVNNLGKANALIQHEWRPRSFFTISGEVDTKAIEKSAKVGLGLALKP*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo