Glyma19g02061 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g02061

Feature Type:	gene_model
Chromosome:	Gm19
Start:	1782740
stop:	1786597
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g02061

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G28460	AT	Annotation by Michelle Graham. TAIR10: methyltransferases \| chr3:10672673-10674297 REVERSE LENGTH=314	SoyBase	E_val: 6.00E-122	ISS
GO:0006364	GO-bp	Annotation by Michelle Graham. GO Biological Process: rRNA processing	SoyBase	N/A	ISS
GO:0006399	GO-bp	Annotation by Michelle Graham. GO Biological Process: tRNA metabolic process	SoyBase	N/A	ISS
GO:0009658	GO-bp	Annotation by Michelle Graham. GO Biological Process: chloroplast organization	SoyBase	N/A	ISS
GO:0009793	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy	SoyBase	N/A	ISS
GO:0010267	GO-bp	Annotation by Michelle Graham. GO Biological Process: production of ta-siRNAs involved in RNA interference	SoyBase	N/A	ISS
GO:0016226	GO-bp	Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly	SoyBase	N/A	ISS
GO:0031167	GO-bp	Annotation by Michelle Graham. GO Biological Process: rRNA methylation	SoyBase	N/A	ISS
GO:0035196	GO-bp	Annotation by Michelle Graham. GO Biological Process: production of miRNAs involved in gene silencing by miRNA	SoyBase	N/A	ISS
GO:0042793	GO-bp	Annotation by Michelle Graham. GO Biological Process: transcription from plastid promoter	SoyBase	N/A	ISS
GO:0045893	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0051607	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to virus	SoyBase	N/A	ISS
GO:0008168	GO-mf	Annotation by Michelle Graham. GO Molecular Function: methyltransferase activity	SoyBase	N/A	ISS
PF03602	PFAM	Conserved hypothetical protein 95	JGI		ISS
UniRef100_I1LWH0	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LWH0_SOYBN	SoyBase	E_val: 6.00E-172	ISS
UniRef100_Q9LSI8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Gb\|AAC66597.1 n=1 Tax=Arabidopsis thaliana RepID=Q9LSI8_ARATH	SoyBase	E_val: 3.00E-119	ISS

Expression Patterns of Glyma19g02061

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g02061 not represented in the dataset	Glyma19g02061 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g02061

Paralog	Evidence	Comments
Glyma13g04900	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g02061 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g017500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g02061

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g02061

Limit To All Plant Sequences

>Glyma19g02061.1   sequence type=CDS   gene model=Glyma19g02061   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGGTTTTGTCGCCTCCAACACTCTCCTTACTCCTTCAAAAAACCAAGATTATTAATTTTCGGGTCACCACCACTTCCTCTTCTCACCTTCTTCTCCTCCTAACCCCTCCTAACCCCTCTTCGTCTCTTACACCAGTAAAATCCGGAAATGGGTTGGCCAGTGAGGACAAAAAAATCTTGCTTGACAAGTATGGCTGCGATGTTGACGCTGATGAGTACTTTTCTCAGTCGTCTTCTAAGTCCAAGAGGAGAAAGGACTCAAAGGAGCAACCAAGGAGAAGAGGAGGGAAGCAAGTGCAGGACCCACCAGAGGACCCTAAGCCTCCTCGTACTACCCATAAATTGCTTCAGGTTCTTGGTGGAACAGCTCGAAGAGTGAAGCTACTCTCACCAAAGGGCATGGATGTACGCCCCATGATGGAAGTGGTGAAAGGTGCAGCCTTTGATATATTACAGGCAGCTGGTGGCTGTCCTGCAGCTCTGAGACCTGGTCACTGGTTAGACTTGTATAGTGGTACAGGTTCTGTTGGAATTGAAGCACTCAGCCGAGGATGTTCTGAGGTGCATTTAGTTGAGATGGATCCATGGGTTGTATCAGACGTGTTACGCCCAAACTTAGAGGAAACTGGATTCCTTGATGCCTCAGTCATACATACTGTCCGTGTGGAAAAATTCTTCGAACGTGCAGAGCAATTTGTAGGCATTGAATGCAATAAATATTTCCATCGTTATCTTCCACCACCGACAACTGCCAAAGTGAGAAACCGTGGCCCATTTGATTACATTAGTGTCACCCCTCCATATACACAAGTTGACTATGGGGTGCTGATGAGGCAAATATCAGAATCATCCTTGATTGGAGAGAACACATTTATTGTAGTTGAGTATGCTTTAAAAACTGACATGCTGGATTCTTGTGGAAGCCTTGTAAAGATAACTGACAGGCGGTTTGGCCGGACACTCTTGGCAATTTATGGACCAACATGGTCCCAGAATAAGAGATGA

Predicted protein sequences of Glyma19g02061

Limit To All Plant Sequences

>Glyma19g02061.1   sequence type=predicted peptide   gene model=Glyma19g02061   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAVLSPPTLSLLLQKTKIINFRVTTTSSSHLLLLLTPPNPSSSLTPVKSGNGLASEDKKILLDKYGCDVDADEYFSQSSSKSKRRKDSKEQPRRRGGKQVQDPPEDPKPPRTTHKLLQVLGGTARRVKLLSPKGMDVRPMMEVVKGAAFDILQAAGGCPAALRPGHWLDLYSGTGSVGIEALSRGCSEVHLVEMDPWVVSDVLRPNLEETGFLDASVIHTVRVEKFFERAEQFVGIECNKYFHRYLPPPTTAKVRNRGPFDYISVTPPYTQVDYGVLMRQISESSLIGENTFIVVEYALKTDMLDSCGSLVKITDRRFGRTLLAIYGPTWSQNKR*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain