SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma19g01675

Feature Type:gene_model
Chromosome:Gm19
Start:1271410
stop:1271829
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma19g01675
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G40170AT Annotation by Michelle Graham. TAIR10: receptor like protein 54 | chr5:16065179-16067557 REVERSE LENGTH=792 SoyBaseE_val: 1.00E-16ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006952GO-bp Annotation by Michelle Graham. GO Biological Process: defense response SoyBaseN/AISS
GO:0007165GO-bp Annotation by Michelle Graham. GO Biological Process: signal transduction SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0016301GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase activity SoyBaseN/AISS
PTHR24420Panther FAMILY NOT NAMED JGI ISS
PTHR24420:SF906Panther JGI ISS
PF00560PFAM Leucine Rich Repeat JGI ISS
UniRef100_B9RMG8UniRef Annotation by Michelle Graham. Best UniRef hit: Serine/threonine-protein kinase bri1, putative n=1 Tax=Ricinus communis RepID=B9RMG8_RICCO SoyBaseE_val: 8.00E-39ISS
UniRef100_B9RMG8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Serine/threonine-protein kinase bri1, putative n=1 Tax=Ricinus communis RepID=B9RMG8_RICCO SoyBaseE_val: 8.00E-39ISS

Expression Patterns of Glyma19g01675
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g01675 not represented in the dataset
Glyma19g01675 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma19g01675 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.19g013900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma19g01675
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma19g01675
>Glyma19g01675.1   sequence type=CDS   gene model=Glyma19g01675   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTCCTTAATCCTTTTCATTGCCAATTCACTAGAGGCATACCAACAAATATTGGAGCACTACATCATTTGGAAAGCCTTGACCTTTCTAGCAACCATATCTCAGGTCCAATTCCTTCAAATATGGCTTCCTTGACTTTCTTGGGACATTTGAACTACTTGTCCTATAACAACTTGTCAGGTGAAATACCCACAGCAAATCAGTTTCATACTTTGACAGATCCCTCCATCTATGAGGGTAATCCACACCTTTGTGGGACACCCTTGTCCATTAAGTGTTCAGAATATGATGATGAAAACACCACAGATGAAGATCTAGACAGTTCCCATGATAAGTTATGGTTATATTTGAGCATAGGACTTGGCTTCATTGTGGGATTTTGGGCTGTTTGTGGCAGCTTAGTATTGAAGGAATGTTGA
Predicted protein sequences of Glyma19g01675
>Glyma19g01675.1   sequence type=predicted peptide   gene model=Glyma19g01675   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFLNPFHCQFTRGIPTNIGALHHLESLDLSSNHISGPIPSNMASLTFLGHLNYLSYNNLSGEIPTANQFHTLTDPSIYEGNPHLCGTPLSIKCSEYDDENTTDEDLDSSHDKLWLYLSIGLGFIVGFWAVCGSLVLKEC*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo