Glyma19g00341 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g00341): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g00341): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma19g00341

Feature Type:	gene_model
Chromosome:	Gm19
Start:	143450
stop:	146372
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g00341

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G11010	AT	Annotation by Michelle Graham. TAIR10: Pre-mRNA cleavage complex II protein family \| chr5:3484176-3486067 FORWARD LENGTH=368	SoyBase	E_val: 1.00E-67	ISS
GO:0006777	GO-bp	Annotation by Michelle Graham. GO Biological Process: Mo-molybdopterin cofactor biosynthetic process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005525	GO-mf	Annotation by Michelle Graham. GO Molecular Function: GTP binding	SoyBase	N/A	ISS
PTHR12755	Panther	CLEAVAGE/POLYADENYLATION FACTOR IA SUBUNIT CLP1P	JGI		ISS
PF06807	PFAM	Pre-mRNA cleavage complex II protein Clp1	JGI		ISS
UniRef100_Q8VYP6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Polynucleotide 5'-hydroxyl-kinase NOL9 n=1 Tax=Arabidopsis thaliana RepID=NOL9_ARATH	SoyBase	E_val: 7.00E-65	ISS
UniRef100_UPI000233F036	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233F036 related cluster n=1 Tax=unknown RepID=UPI000233F036	SoyBase	E_val: 3.00E-109	ISS

Expression Patterns of Glyma19g00341

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g00341 not represented in the dataset	Glyma19g00341 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma19g00341

Paralog	Evidence	Comments
Glyma05g08830	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma19g00341 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g005300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g00341

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g00341

Limit To All Plant Sequences

>Glyma19g00341.1   sequence type=CDS   gene model=Glyma19g00341   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GGTGTGCTTGTTCAGAAGGATGCACGTCTCCTACGTGATTTACGAATAATGGCTTATTTCAAACAGTGCTTTTCTAGTGATTCAAATATTTCTACAATCAAGGAACTTGCACATGCCTTGGCCTCTCACTGTCCTTATGAAGTTCCAATTGCAAGCATAAAGATTCGACATCTTCATTGTGAGGTCCCAAGCTCTGAAATATTCTTCAGTTTGAATGCTACCATTGTTGGCTTAGCCGTTGATTCTGAAGGACCTGAAAATTTACCTTCGTGTCTTGGTCTTGGGATTGTGAGGGGAATTGACATAGTCAAAGCTATGCTTTATGTCATTACTCCCGTGCCACATAATTCTCTCGAAAAAGTCAACGTGTTGCTACAGGGTTATATCCAAATTCCATCTTGTTTATTGCAGGTTCAAGGATGCATCTCACCTTACATGTCAGCAAATACTTTGACTTTGACTACAAACTAG

Predicted protein sequences of Glyma19g00341

Limit To All Plant Sequences

>Glyma19g00341.1   sequence type=predicted peptide   gene model=Glyma19g00341   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GVLVQKDARLLRDLRIMAYFKQCFSSDSNISTIKELAHALASHCPYEVPIASIKIRHLHCEVPSSEIFFSLNATIVGLAVDSEGPENLPSCLGLGIVRGIDIVKAMLYVITPVPHNSLEKVNVLLQGYIQIPSCLLQVQGCISPYMSANTLTLTTN*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain