Glyma19g00270 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma19g00270): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma19g00270): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma19g00270

Feature Type:	gene_model
Chromosome:	Gm19
Start:	86882
stop:	92780
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma19g00270

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G01550	AT	Annotation by Michelle Graham. TAIR10: phosphoenolpyruvate (pep)/phosphate translocator 2 \| chr3:216947-218856 REVERSE LENGTH=383	SoyBase	E_val: 5.00E-150	ISS
GO:0006810	GO-bp	Annotation by Michelle Graham. GO Biological Process: transport	SoyBase	N/A	ISS
GO:0006863	GO-bp	Annotation by Michelle Graham. GO Biological Process: purine nucleobase transport	SoyBase	N/A	ISS
GO:0009718	GO-bp	Annotation by Michelle Graham. GO Biological Process: anthocyanin-containing compound biosynthetic process	SoyBase	N/A	ISS
GO:0015713	GO-bp	Annotation by Michelle Graham. GO Biological Process: phosphoglycerate transport	SoyBase	N/A	ISS
GO:0015714	GO-bp	Annotation by Michelle Graham. GO Biological Process: phosphoenolpyruvate transport	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0016021	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane	SoyBase	N/A	ISS
GO:0005215	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transporter activity	SoyBase	N/A	ISS
GO:0015120	GO-mf	Annotation by Michelle Graham. GO Molecular Function: phosphoglycerate transmembrane transporter activity	SoyBase	N/A	ISS
GO:0015121	GO-mf	Annotation by Michelle Graham. GO Molecular Function: phosphoenolpyruvate:phosphate antiporter activity	SoyBase	N/A	ISS
GO:0015297	GO-mf	Annotation by Michelle Graham. GO Molecular Function: antiporter activity	SoyBase	N/A	ISS
KOG1441	KOG	Glucose-6-phosphate/phosphate and phosphoenolpyruvate/phosphate antiporter	JGI		ISS
PTHR11132	Panther	SOLUTE CARRIER FAMILY 35	JGI		ISS
PF00892	PFAM	EamA-like transporter family	JGI		ISS
PF03151	PFAM	Triose-phosphate Transporter family	JGI		ISS
UniRef100_G7KHI6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Phosphate/phosphoenolpyruvate translocator n=1 Tax=Medicago truncatula RepID=G7KHI6_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_I1N5H8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N5H8_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma19g00270

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma19g00270 not represented in the dataset	Glyma19g00270 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma19g00270 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.19g005900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma19g00270

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma19g00270

Limit To All Plant Sequences

>Glyma19g00270.1   sequence type=CDS   gene model=Glyma19g00270   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTCCTTATTCTCTCTCTTTGTTAGCCTCTGTCTCCCCCAAAATGCACACCCTTCTTTCTTTCTCCTCATCACACTCTCCACATCTTCCAAACCACAACATAACCAAATCCAATAATAAACTCTCTCATTCCATCAATGGACTTTCATCATGCCCTTCTTCTCCTTTGCTCCCCAGTGCCACAAAATCTTCTCCCTTTCTCATTTCCACTTCAAAAATTGCATCTTTCAGGGTCCTTGCTGCTTCCTCTATACCTGATGCTAGAAGTGATGAACCAGCCAAAACTAGTGATTTCTTAAAAACTCTTCAGCTTGGGGCCATGTTTGCAACTTGGTACCTTTTGAACATCTACTACAACATCTACAACAAACAGGTTCTAAAAGTCTATCCATTTCCAGCAACAATTACAGCATTTCAATTTGGCTTTGCATCGTTGGTTATTAATCTAGTCTGGACTTTGAATCTCCATCCCAGACCAAGCATCAGTGGTTCACAGTTTGCAGCAATCCTTCCACTGGCTGTGGCTCACACAATGGGAAACCTCTTGACCAACATTAGTCTTGGCAAGGTTGCTGTATCTTTCACTCACACAATCAAAGCTATGGAGCCTTTCTTCACTGTAGTTCTTTCTGCCCTTTTACTGGGTGAGATGCCTACTTTCTGGGTGGTTTCTTCCCTTGTACCAGTAGTAGGTGGAGTGGCACTGGCATCAATGACTGAAGTCTCTTTCAATTGGATTGGATTCACTACTGCTATGGCATCTAACGTTACTAATCAATCGCGGAACGTTTTGAGCAAAAAACTGATGACTAATGAAGAGGAAACTTTGGACAATATCAATCTCTACTCAGTTATAACTATCATTTCCTTTCTGTTGTTGGTCCCATGTGCTATTCTTGTGGAGGGTGTCAAGTTTTCTCCTTCATACTTGCAATCTGCTGCAAGTCAAGGGCTGAATGTCAGAGAGCTATGTGTCAGATCAGTTCTTGCTGCTTTTTGCTTCCATGCATACCAGCAGGTATCATATATGATATTACAGATGGTGTCACCTGTGACCCACTCTGTTGGAAACTGTGTGAAGCGTGTGGTTGTCATTGTTTCTTCAGTTATATTCTTCCAAATTCCTGTCTCACCCGTTAACACACTTGGAACTGGGCTTGCACTTGTTGGAGTTTTCTTGTACTCAAGGGCAAAGAGGATCAAGTCAGTCCAAAAGACAAATTGA

Predicted protein sequences of Glyma19g00270

Limit To All Plant Sequences

>Glyma19g00270.1   sequence type=predicted peptide   gene model=Glyma19g00270   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSPYSLSLLASVSPKMHTLLSFSSSHSPHLPNHNITKSNNKLSHSINGLSSCPSSPLLPSATKSSPFLISTSKIASFRVLAASSIPDARSDEPAKTSDFLKTLQLGAMFATWYLLNIYYNIYNKQVLKVYPFPATITAFQFGFASLVINLVWTLNLHPRPSISGSQFAAILPLAVAHTMGNLLTNISLGKVAVSFTHTIKAMEPFFTVVLSALLLGEMPTFWVVSSLVPVVGGVALASMTEVSFNWIGFTTAMASNVTNQSRNVLSKKLMTNEEETLDNINLYSVITIISFLLLVPCAILVEGVKFSPSYLQSAASQGLNVRELCVRSVLAAFCFHAYQQVSYMILQMVSPVTHSVGNCVKRVVVIVSSVIFFQIPVSPVNTLGTGLALVGVFLYSRAKRIKSVQKTN*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain