SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g53610

Feature Type:gene_model
Chromosome:Gm18
Start:61885300
stop:61888619
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g53610
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G02520AT Annotation by Michelle Graham. TAIR10: general regulatory factor 7 | chr3:526800-527915 REVERSE LENGTH=265 SoyBaseE_val: 3.00E-168ISS
GO:0006486GO-bp Annotation by Michelle Graham. GO Biological Process: protein glycosylation SoyBaseN/AISS
GO:0006888GO-bp Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0009407GO-bp Annotation by Michelle Graham. GO Biological Process: toxin catabolic process SoyBaseN/AISS
GO:0043090GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid import SoyBaseN/AISS
GO:0005635GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nuclear envelope SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0019904GO-mf Annotation by Michelle Graham. GO Molecular Function: protein domain specific binding SoyBaseN/AISS
GO:0045309GO-mf Annotation by Michelle Graham. GO Molecular Function: protein phosphorylated amino acid binding SoyBaseN/AISS
KOG0841 KOG Multifunctional chaperone (14-3-3 family) JGI ISS
PTHR18860Panther 14-3-3 JGI ISS
PF00244PFAM 14-3-3 protein JGI ISS
UniRef100_E9KNA6UniRef Annotation by Michelle Graham. Most informative UniRef hit: SGF14a n=1 Tax=Glycine max RepID=E9KNA6_SOYBN SoyBaseE_val: 0ISS
UniRef100_E9KNA6UniRef Annotation by Michelle Graham. Best UniRef hit: SGF14a n=1 Tax=Glycine max RepID=E9KNA6_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma18g53610
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g53610
ParalogEvidenceComments
Glyma08g47900 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g53610 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g298300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g53610
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g53610
>Glyma18g53610.1   sequence type=CDS   gene model=Glyma18g53610   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCGGATTCTTCTCGGGAGGAGAATGTTTACATGGCGAAATTGGCGGAGCAGGCCGAGCGTTACGAGGAGATGGTTGAGTTCATGGAGAAGGTAGCAAAGACTGTGGAGGTTGAGGAGTTGACGGTGGAGGAGAGAAATCTTCTCTCTGTGGCTTACAAGAACGTGATTGGTGCGAGGAGGGCTTCGTGGAGGATCATATCCTCCATTGAGCAGAAGGAGGAGAGCAGGGGCAATGAGGACCATGTGGCCATTATAAAGGAGTACAGGGGCAAAATTGAGGCTGAACTCAGCAAGATCTGTGACGGGATTTTGAACCTCCTTGAGTCCAACCTCATCCCATCCGCCGCATCTCCCGAGAGTAAAGTGTTTTACCTTAAAATGAAGGGTGATTACCACAGGTACCTTGCCGAGTTCAAGACTGGGGCAGAGAGGAAAGAGGCAGCAGAGAGTACTTTGCTTGCTTACAAATCTGCTCAGGATATTGCTCTTGCTGACTTGGCCCCCACTCACCCCATTAGGCTGGGACTTGCTCTCAACTTTTCTGTCTTCTATTATGAAATCCTTAACTCGCCAGATCGGGCTTGTAATCTTGCCAAACAGGCATTTGATGAGGCAATTTCCGAGCTTGACACATTGGGTGAAGAGTCATACAAGGATAGTACGTTGATCATGCAACTTCTCCGTGACAATCTGACTTTGTGGACATCAGACATCACGGACGATGCTGGAGATGAGATCAAGGAAACATCTAAGCAACAACCAGGTGAATAG
Predicted protein sequences of Glyma18g53610
>Glyma18g53610.1   sequence type=predicted peptide   gene model=Glyma18g53610   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSDSSREENVYMAKLAEQAERYEEMVEFMEKVAKTVEVEELTVEERNLLSVAYKNVIGARRASWRIISSIEQKEESRGNEDHVAIIKEYRGKIEAELSKICDGILNLLESNLIPSAASPESKVFYLKMKGDYHRYLAEFKTGAERKEAAESTLLAYKSAQDIALADLAPTHPIRLGLALNFSVFYYEILNSPDRACNLAKQAFDEAISELDTLGEESYKDSTLIMQLLRDNLTLWTSDITDDAGDEIKETSKQQPGE*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo