Glyma18g52730 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g52730

Feature Type:	gene_model
Chromosome:	Gm18
Start:	61241549
stop:	61242406
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g52730

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G44310	AT	Annotation by Michelle Graham. TAIR10: Calcium-binding EF-hand family protein \| chr2:18309285-18309713 FORWARD LENGTH=142	SoyBase	E_val: 6.00E-39	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0005509	GO-mf	Annotation by Michelle Graham. GO Molecular Function: calcium ion binding	SoyBase	N/A	ISS
PTHR24753	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24753:SF14	Panther		JGI		ISS
UniRef100_B9SSH4	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Calcium ion binding protein, putative n=1 Tax=Ricinus communis RepID=B9SSH4_RICCO	SoyBase	E_val: 2.00E-66	ISS
UniRef100_I1N565	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N565_SOYBN	SoyBase	E_val: 2.00E-93	ISS

Expression Patterns of Glyma18g52730

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma18g52730 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g290300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g52730

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g52730

Limit To All Plant Sequences

>Glyma18g52730.1   sequence type=CDS   gene model=Glyma18g52730   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGTGTAGAAATTTTGGATGGTGCCACCATTGTCAACTTCCTTCAGGATGAAGAAGCATTCAGTGCCTCAGTTCTTAACCGGTTCGCCTACCTTGACACAGACAATGATGGCCTTCTCTCGTATGCGGAGATGTTGAAGGAGCTCCAAAGCTTGAGGGTGTTGGAAACGCACTTTGGTATTGATGTGGAGCCAGACCCAGATGAGCTTGCTCGTGTTTATGAATCCTTGTTCGTACAATTCGATCACAACTTGAATGGCACCATTGATCTCGACGAATTCAAGAAGGAAACGAAGCAGATGATGCTTGCCATGGCAAATGGATTGGGCTTCTTGCCGGTTCAGATGGTCTTGGAAGAAGACAGCATCCTCAAAAAAGCTGTTGAAAGGGAGTTCCCAAAAGTGGCTTCTTAA

Predicted protein sequences of Glyma18g52730

Limit To All Plant Sequences

>Glyma18g52730.1   sequence type=predicted peptide   gene model=Glyma18g52730   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSVEILDGATIVNFLQDEEAFSASVLNRFAYLDTDNDGLLSYAEMLKELQSLRVLETHFGIDVEPDPDELARVYESLFVQFDHNLNGTIDLDEFKKETKQMMLAMANGLGFLPVQMVLEEDSILKKAVEREFPKVAS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain