SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g51920

Feature Type:gene_model
Chromosome:Gm18
Start:60676142
stop:60684489
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g51920
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G05840AT Annotation by Michelle Graham. TAIR10: Eukaryotic aspartyl protease family protein | chr1:1762843-1766150 REVERSE LENGTH=485 SoyBaseE_val: 0ISS
GO:0000303GO-bp Annotation by Michelle Graham. GO Biological Process: response to superoxide SoyBaseN/AISS
GO:0006301GO-bp Annotation by Michelle Graham. GO Biological Process: postreplication repair SoyBaseN/AISS
GO:0006499GO-bp Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation SoyBaseN/AISS
GO:0006508GO-bp Annotation by Michelle Graham. GO Biological Process: proteolysis SoyBaseN/AISS
GO:0006511GO-bp Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0006635GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid beta-oxidation SoyBaseN/AISS
GO:0006869GO-bp Annotation by Michelle Graham. GO Biological Process: lipid transport SoyBaseN/AISS
GO:0006891GO-bp Annotation by Michelle Graham. GO Biological Process: intra-Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0007165GO-bp Annotation by Michelle Graham. GO Biological Process: signal transduction SoyBaseN/AISS
GO:0008219GO-bp Annotation by Michelle Graham. GO Biological Process: cell death SoyBaseN/AISS
GO:0009755GO-bp Annotation by Michelle Graham. GO Biological Process: hormone-mediated signaling pathway SoyBaseN/AISS
GO:0009863GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009873GO-bp Annotation by Michelle Graham. GO Biological Process: ethylene mediated signaling pathway SoyBaseN/AISS
GO:0010351GO-bp Annotation by Michelle Graham. GO Biological Process: lithium ion transport SoyBaseN/AISS
GO:0016558GO-bp Annotation by Michelle Graham. GO Biological Process: protein import into peroxisome matrix SoyBaseN/AISS
GO:0044265GO-bp Annotation by Michelle Graham. GO Biological Process: cellular macromolecule catabolic process SoyBaseN/AISS
GO:0048573GO-bp Annotation by Michelle Graham. GO Biological Process: photoperiodism, flowering SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0031225GO-cc Annotation by Michelle Graham. GO Cellular Compartment: anchored to membrane SoyBaseN/AISS
GO:0004190GO-mf Annotation by Michelle Graham. GO Molecular Function: aspartic-type endopeptidase activity SoyBaseN/AISS
KOG1339 KOG Aspartyl protease JGI ISS
PTHR13683Panther ASPARTYL PROTEASES JGI ISS
PTHR13683:SF98Panther CHLOROPLAST NUCLEIOD DNA-BINDING-RELATED JGI ISS
PF00026PFAM Eukaryotic aspartyl protease JGI ISS
UniRef100_G7KTS2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Aspartic proteinase-like protein n=1 Tax=Medicago truncatula RepID=G7KTS2_MEDTR SoyBaseE_val: 0ISS
UniRef100_UPI000233EFBAUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233EFBA related cluster n=1 Tax=unknown RepID=UPI000233EFBA SoyBaseE_val: 0ISS

Expression Patterns of Glyma18g51920
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g51920
ParalogEvidenceComments
Glyma08g29040 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g51920 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g283100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g51920
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g51920
>Glyma18g51920.1   sequence type=CDS   gene model=Glyma18g51920   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGATGCTTCGCAGAAGCAGCAGAAGACTCTTCGTCTCCGCGTGTCTGTGGTTGCTTCTGTCACCGTCACCGTCACCGTCACCGTTGAGTGTCGTTAGCGCCGCCCACGGCGTGTTCAACGTGAAGTGCAAGTATCAGGACCGCACCCTCTCCGCCCTCAAAGCCCACGACTACCGCCGCCAGCTCTCCCTCCTCGCCGGCGTCGACCTCCCCCTCGGAGGCTCCGGCCGCCCCGACGCCGTCGGGCTTTATTACGCTAAAATTGGTATTGGAACTCCTCCGAAGAATTACTATTTGCAGGTGGACACTGGCAGTGACATTATGTGGGTGAATTGCATTCAGTGCAAAGAATGCCCCACCAGAAGCAACCTTGGTATGGACCTTACACTCTACGACATAAAGGAATCCTCCTCTGGTAAATTTGTTCCCTGTGATCAAGAGTTTTGCAAAGAGATCAATGGGGGTCTGCTGACCGGATGCACTGCTAATATTTCCTGTCCATATCTGGAGATATATGGTGATGGGAGCTCGACTGCTGGTTACTTTGTAAAGGATATCGTACTTTATGATCAAGTGTCTGGGGACCTTAAAACTGATTCAGCAAATGGAAGTATTGTATTTGGGTGTGGTGCAAGACAATCTGGAGATCTAAGTTCTTCGAATGAAGAGGCACTTGGTGGAATACTTGGATTTGGAAAAGCTAATTCATCAATGATTTCACAACTTGCTTCTTCTGGCAAAGTGAAAAAGATGTTTGCTCATTGCTTAAATGGAGTAAATGGAGGTGGTATATTTGCTATTGGGCATGTTGTGCAACCTAAAGTAAACATGACTCCATTATTACCAGACCAGCCACACTACAGTGTTAATATGACTGCAGTTCAAGTTGGCCATGCTTTCCTTAGTCTATCAACAGATACATCAACACAAGGAGACAGAAAAGGGACAATAATTGACAGTGGTACAACCTTGGCCTATCTGCCTGAAGGAATTTATGAGCCGCTAGTATATAAGATAATTTCTCAGCACCCCGATCTAAAAGTTCGGACTCTCCATGACGAGTATACGTGCTTTCAATATTCCGAGAGTGTTGATGATGGATTTCCAGCTGTCACATTTTATTTTGAAAATGGGCTCTCGTTGAAGGTTTATCCTCATGATTATTTATTTCCCTCTGGAGATTTCTGGTGTATTGGTTGGCAAAATAGTGGGACACAATCAAGAGATAGCAAAAATATGACCTTATTGGGAGATTTAGTGCTTTCAAATAAACTTGTCTTCTATGACCTTGAAAATCAGGTTATTGGATGGACTGAGTACAACTGTTCTTCAAGCATTAAAGTGAGGGATGAGCGAACGGGAACAGTCCATTTAGTTGGTTTCCACTACATTTCTTTTGCTTGTGGTTTAAACATCAACTTGGTGATGATTTTGTCTCTACTTGCTCTACTTCATAAATGGGTATATTGA
Predicted protein sequences of Glyma18g51920
>Glyma18g51920.1   sequence type=predicted peptide   gene model=Glyma18g51920   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEMLRRSSRRLFVSACLWLLLSPSPSPSPLSVVSAAHGVFNVKCKYQDRTLSALKAHDYRRQLSLLAGVDLPLGGSGRPDAVGLYYAKIGIGTPPKNYYLQVDTGSDIMWVNCIQCKECPTRSNLGMDLTLYDIKESSSGKFVPCDQEFCKEINGGLLTGCTANISCPYLEIYGDGSSTAGYFVKDIVLYDQVSGDLKTDSANGSIVFGCGARQSGDLSSSNEEALGGILGFGKANSSMISQLASSGKVKKMFAHCLNGVNGGGIFAIGHVVQPKVNMTPLLPDQPHYSVNMTAVQVGHAFLSLSTDTSTQGDRKGTIIDSGTTLAYLPEGIYEPLVYKIISQHPDLKVRTLHDEYTCFQYSESVDDGFPAVTFYFENGLSLKVYPHDYLFPSGDFWCIGWQNSGTQSRDSKNMTLLGDLVLSNKLVFYDLENQVIGWTEYNCSSSIKVRDERTGTVHLVGFHYISFACGLNINLVMILSLLALLHKWVY*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo