Glyma18g51431 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g51431

Feature Type:	gene_model
Chromosome:	Gm18
Start:	60315157
stop:	60315920
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g51431

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G38760	AT	Annotation by Michelle Graham. TAIR10: Late embryogenesis abundant protein (LEA) family protein \| chr5:15524249-15524743 FORWARD LENGTH=67	SoyBase	E_val: 7.00E-20	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0019953	GO-bp	Annotation by Michelle Graham. GO Biological Process: sexual reproduction	SoyBase	N/A	ISS
GO:0048445	GO-bp	Annotation by Michelle Graham. GO Biological Process: carpel morphogenesis	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
UniRef100_C6SZR5	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6SZR5_SOYBN	SoyBase	E_val: 4.00E-35	ISS
UniRef100_G9M8Q3	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Thrum pollen-predominant protein 1 n=1 Tax=Linum grandiflorum RepID=G9M8Q3_9ROSI	SoyBase	E_val: 3.00E-19	ISS

Expression Patterns of Glyma18g51431

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g51431 not represented in the dataset	Glyma18g51431 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g51431

Paralog	Evidence	Comments
Glyma08g28515	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g51431 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g279300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g51431

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g51431

Limit To All Plant Sequences

>Glyma18g51431.1   sequence type=CDS   gene model=Glyma18g51431   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATCAATCCCAGAATGCGAGCCATCAAGCTGGCCAAGCCATGGGACAAGCTCGGGAGAAGGCAAGCAACATGATGAACAGTGCAGGCAATGCTGCTCAAAATGTCAAAGAATCCTGCCAAGAGACTGGCCAGCAAATGCAGCAAAAGGCACAAGGGGCTGCTGATGCTGCCAAGAATGCAGTTGGGGCTAACAAATGA

Predicted protein sequences of Glyma18g51431

Limit To All Plant Sequences

>Glyma18g51431.1   sequence type=predicted peptide   gene model=Glyma18g51431   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDQSQNASHQAGQAMGQAREKASNMMNSAGNAAQNVKESCQETGQQMQQKAQGAADAAKNAVGANK*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain