Glyma18g49990 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g49990

Feature Type:	gene_model
Chromosome:	Gm18
Start:	59262557
stop:	59265727
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g49990

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G61190	AT	Annotation by Michelle Graham. TAIR10: putative endonuclease or glycosyl hydrolase with C2H2-type zinc finger domain \| chr5:24615480-24619886 FORWARD LENGTH=995	SoyBase	E_val: 1.00E-14	ISS
GO:0005622	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: intracellular	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0003676	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
PTHR23067	Panther	DOUBLE-STRANDED RNA-BINDING ZINC FINGER PROTEIN	JGI		ISS
PTHR23067:SF18	Panther	SUBFAMILY NOT NAMED	JGI		ISS
UniRef100_C6TD17	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TD17_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q7XFT9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Expressed protein n=1 Tax=Oryza sativa Japonica Group RepID=Q7XFT9_ORYSJ	SoyBase	E_val: 8.00E-33	ISS

Expression Patterns of Glyma18g49990

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g49990

Paralog	Evidence	Comments
Glyma08g26510	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g49990 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g265000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g49990

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g49990

Limit To All Plant Sequences

>Glyma18g49990.1   sequence type=CDS   gene model=Glyma18g49990   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAATACAGCAATTGGGCTGAATCTCTTCAAACCGAAACCCCTCTACCTTCTTTCCCACAACCCTCATCATCATATCCTCCTACCTATTACCCCTCTTACCCTCAAAACCCTAACCCTAACCCTTCTTCTTCTCTTCCCCTTAACCCTCCCGGGGTTGATCCCCAAACCCCATTGAACCCTATTAGCTATGCGGCTCATGAACCCGTTCCTGGTTTGGTCTACGCTCAGAGCCTTGTTGGGGATGATTCATCTTCTGGGTATTGCTTGGACCATAATTGGGTTGCCAGAGAGGCTGTTAGGCAATTTGGTACTGACCCTACTCTTTATGCACCTGGCATCTCTTTGCCACCCAATGGCTCAGAACAGTTGGCTATGGCAAATCCTAGCTCTTTGTGGTGGACAAATACCACAACTCAACCTCATGTCAATGGAACACCTAAGAAAAACCAAAAGAAAACTAAGGTTGTGCAACCTGCATTTTGCGAAGTTTGCAAGATAGAATGCACCGGCAAGGAAGTGCTGGACCAGCATAAATTAGGAAAGAAGCACAAGAAGAACGTGGAGAAACTAAGGGAATCATTGACACCTACCCAAGTTCAACCATCTGGGTCATCTAAGCCTTTAATAGGACCCCAATTACCGGATGATAAGGGCAAATCCATCAGTGGGAATAAGAGTAAGAGAAAAAAAGTTGAAACTGCAGAGGATTTGGAGAAAAAGAAAATGAAAGTTCTTATGGGTGGGGCAGCAGCTTCAGCAGTTAAGATATGTGCTATATGTAACGTGGTGTGTAATAGTGAGACGGTTTATAACTATCATCTTGCAGGACAAAAGCATGCTGCTATGCAGAAGAAAGCATCGGGTCATACACAATCCAATGCCTGTTGA

Predicted protein sequences of Glyma18g49990

Limit To All Plant Sequences

>Glyma18g49990.1   sequence type=predicted peptide   gene model=Glyma18g49990   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEYSNWAESLQTETPLPSFPQPSSSYPPTYYPSYPQNPNPNPSSSLPLNPPGVDPQTPLNPISYAAHEPVPGLVYAQSLVGDDSSSGYCLDHNWVAREAVRQFGTDPTLYAPGISLPPNGSEQLAMANPSSLWWTNTTTQPHVNGTPKKNQKKTKVVQPAFCEVCKIECTGKEVLDQHKLGKKHKKNVEKLRESLTPTQVQPSGSSKPLIGPQLPDDKGKSISGNKSKRKKVETAEDLEKKKMKVLMGGAAASAVKICAICNVVCNSETVYNYHLAGQKHAAMQKKASGHTQSNAC*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain