Glyma18g49880 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g49880

Feature Type:	gene_model
Chromosome:	Gm18
Start:	59175797
stop:	59177417
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g49880

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G15390	AT	Annotation by Michelle Graham. TAIR10: tRNA/rRNA methyltransferase (SpoU) family protein \| chr5:4995333-4997255 FORWARD LENGTH=350	SoyBase	E_val: 1.00E-79	ISS
GO:0006396	GO-bp	Annotation by Michelle Graham. GO Biological Process: RNA processing	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0003723	GO-mf	Annotation by Michelle Graham. GO Molecular Function: RNA binding	SoyBase	N/A	ISS
GO:0008173	GO-mf	Annotation by Michelle Graham. GO Molecular Function: RNA methyltransferase activity	SoyBase	N/A	ISS
PTHR12029	Panther	RNA METHYLASE	JGI		ISS
PTHR12029:SF22	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF00588	PFAM	SpoU rRNA Methylase family	JGI		ISS
UniRef100_G7L451	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: tRNA guanosine-2'-O-methyltransferase n=1 Tax=Medicago truncatula RepID=G7L451_MEDTR	SoyBase	E_val: 4.00E-92	ISS
UniRef100_I1N4H4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1N4H4_SOYBN	SoyBase	E_val: 3.00E-121	ISS

Expression Patterns of Glyma18g49880

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g49880

Paralog	Evidence	Comments
Glyma08g26320	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g49880 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g263800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g49880

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g49880

Limit To All Plant Sequences

>Glyma18g49880.1   sequence type=CDS   gene model=Glyma18g49880   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATGCCAATGCATGATTCGAGTTTCACAATTATTGAGGCGTATAAAGATAATCGCCATGTGAGCATGGGTGCAGAGAAATGGTTGGACATTGAACTGTGGGACTCTACAAAGGAGTGCTTTAAAATGTTGAAATCACGCGGTTATCGAATTGCCACAACTCATGTGGGAATGGATGCGGTCTCTATTCTTGATTTAGATTGGTCCAGCCCAACTACAATCGTGGTTGGGAATGAAAATAGGGGTATTAGTGATGAGGCATTGGAGTTGTCAGATCTGCATTGCAGTATTCCTATGGCAGGAATGGTGAAGTCTTTCAATGTTTCAGTTGCTGCAGGAATCCTCATGCACCATGCTGTTTGTGATAGAATATCTCGTATGGGCTATCATGGTGATATGACAGTAGAAGAATGCCAGATTCTACTTGCAGAGTTTTTGTTGCGTCATAGCAAGAGTTCGATTAGTATTGTTGAAGATTATGCAATGCGTAAAGCAGTAACATTGACTTAA

Predicted protein sequences of Glyma18g49880

Limit To All Plant Sequences

>Glyma18g49880.1   sequence type=predicted peptide   gene model=Glyma18g49880   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MMPMHDSSFTIIEAYKDNRHVSMGAEKWLDIELWDSTKECFKMLKSRGYRIATTHVGMDAVSILDLDWSSPTTIVVGNENRGISDEALELSDLHCSIPMAGMVKSFNVSVAAGILMHHAVCDRISRMGYHGDMTVEECQILLAEFLLRHSKSSISIVEDYAMRKAVTLT*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain