SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g49870

Feature Type:gene_model
Chromosome:Gm18
Start:59169158
stop:59171068
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g49870
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G54160AT Annotation by Michelle Graham. TAIR10: O-methyltransferase 1 | chr5:21982075-21984167 FORWARD LENGTH=363 SoyBaseE_val: 2.00E-103ISS
GO:0006598GO-bp Annotation by Michelle Graham. GO Biological Process: polyamine catabolic process SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009698GO-bp Annotation by Michelle Graham. GO Biological Process: phenylpropanoid metabolic process SoyBaseN/AISS
GO:0009805GO-bp Annotation by Michelle Graham. GO Biological Process: coumarin biosynthetic process SoyBaseN/AISS
GO:0009809GO-bp Annotation by Michelle Graham. GO Biological Process: lignin biosynthetic process SoyBaseN/AISS
GO:0009963GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of flavonoid biosynthetic process SoyBaseN/AISS
GO:0016126GO-bp Annotation by Michelle Graham. GO Biological Process: sterol biosynthetic process SoyBaseN/AISS
GO:0042398GO-bp Annotation by Michelle Graham. GO Biological Process: cellular modified amino acid biosynthetic process SoyBaseN/AISS
GO:0051555GO-bp Annotation by Michelle Graham. GO Biological Process: flavonol biosynthetic process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0030744GO-mf Annotation by Michelle Graham. GO Molecular Function: luteolin O-methyltransferase activity SoyBaseN/AISS
GO:0030755GO-mf Annotation by Michelle Graham. GO Molecular Function: quercetin 3-O-methyltransferase activity SoyBaseN/AISS
GO:0033799GO-mf Annotation by Michelle Graham. GO Molecular Function: myricetin 3'-O-methyltransferase activity SoyBaseN/AISS
GO:0047763GO-mf Annotation by Michelle Graham. GO Molecular Function: caffeate O-methyltransferase activity SoyBaseN/AISS
KOG3178 KOG Hydroxyindole-O-methyltransferase and related SAM-dependent methyltransferases JGI ISS
PTHR11746Panther O-METHYLTRANSFERASE JGI ISS
PF00891PFAM O-methyltransferase JGI ISS
PF08100PFAM Dimerisation domain JGI ISS
UniRef100_G7L351UniRef Annotation by Michelle Graham. Most informative UniRef hit: Isoliquiritigenin 2'-O-methyltransferase n=1 Tax=Medicago truncatula RepID=G7L351_MEDTR SoyBaseE_val: 0ISS
UniRef100_UPI000189DA15UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000189DA15 related cluster n=1 Tax=unknown RepID=UPI000189DA15 SoyBaseE_val: 0ISS

Expression Patterns of Glyma18g49870
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma18g49870 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g263700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g49870
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g49870
>Glyma18g49870.1   sequence type=CDS   gene model=Glyma18g49870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGTTCGTGTTGCTTAGAGAAAGAGAACCATGTGGTGGAAACTGCCACCCCACAAAGAGAAGACACTGATATTATCCTGGATGCCATGGTGCTCGGTTCCAATGTGGTCTTTCCTGCCGCTCTCAACGCTGCAATTGAGCTCAAAGTGTTTGAGATCATTGGGAAGGAAAGCTCAGAAGAGAGTGGTGGATTCATGTCACCCCATGAAATTGCTTCCAAGTTGTTATTACCAACACAACAACACCACTCTGACTTGCCAAATAGGCTTGAGCGTTTGTTGCTCTTGCTTGCTAGCTACTCTCTTCTCACTGTTTCCACTCGCACCGATGAGAATGGTAGCGCCGTGAGAGTTTATGCGGTCTCACCATCGGGTAAATATTTCGTCTATGATAAAAATGGTGGTGGCTATCTTGCTTCATTCACATCATTTCTGTGTCACCCTGCGATGTTAGGAGTATGGTTGAATTTTAAGGAAGCGATTATTGATCCTGAGATTGACCTATTCAAGAAGGTTCATGGAATTTCTAAGTTCGAGTACTTTGGGAAAGAACCAGAACTAAACCACGTATTTAACAAAGCAATGAATGATGTATGCACAACCCATATGAAAAAAATACTTGAAGTATACACAGGATATGAGGGTATATCAACTTTGGTTAATGTAGCAGGTGGAACTGGACAATGTCTCAAATTGATCATCTCCAAATACCCTTCAATTAAGGGAATTAATTTTGACCTCCCACATGTGATTGAAAATTCACCACCCATTCCAGGGGTTGAGCATATTGGGGGAAATATGTTTGAAGGTGTTCCACAAGGTGATGCCATAATGCTAAAGGCCATATGCCATAATTGGTCGGATGAAAAAGCCATAGAACTTTTAAGCAATTGTCACAAAGCTTTGCCACCAAACGGGAAGGTCATTGTTGGGGATCTCATAGTGCCAGAAGATCCAGAACCTACAAATGATTGCAAAATGATTTCAATTCTTGATAACATCATGTTTATTACACCTGGTGGAAGGGAAAGAACTGAGAAACAATTTGAAAGTTTGGGCAAGCGTTCTGGATTTTCTAGGTTTCAAGTTGTTTGTCGGGCTTTCTCTACTATGGCAGTGATGGAATTTTACAAATAA
Predicted protein sequences of Glyma18g49870
>Glyma18g49870.1   sequence type=predicted peptide   gene model=Glyma18g49870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSSCCLEKENHVVETATPQREDTDIILDAMVLGSNVVFPAALNAAIELKVFEIIGKESSEESGGFMSPHEIASKLLLPTQQHHSDLPNRLERLLLLLASYSLLTVSTRTDENGSAVRVYAVSPSGKYFVYDKNGGGYLASFTSFLCHPAMLGVWLNFKEAIIDPEIDLFKKVHGISKFEYFGKEPELNHVFNKAMNDVCTTHMKKILEVYTGYEGISTLVNVAGGTGQCLKLIISKYPSIKGINFDLPHVIENSPPIPGVEHIGGNMFEGVPQGDAIMLKAICHNWSDEKAIELLSNCHKALPPNGKVIVGDLIVPEDPEPTNDCKMISILDNIMFITPGGRERTEKQFESLGKRSGFSRFQVVCRAFSTMAVMEFYK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo