SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Notice: fwrite(): Write of 157 bytes failed with errno=28 No space left on device in /var/www/html/include/SeqFeatClass.php on line 369

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma18g49196): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma18g49196): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma18g49196

Feature Type:gene_model
Chromosome:Gm18
Start:58599604
stop:58601143
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G41370AT Annotation by Michelle Graham. TAIR10: homolog of xeroderma pigmentosum complementation group B 1 | chr5:16551337-16555792 FORWARD LENGTH=767 SoyBaseE_val: 4.00E-45ISS
GO:0006289GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide-excision repair SoyBaseN/AISS
GO:0009411GO-bp Annotation by Michelle Graham. GO Biological Process: response to UV SoyBaseN/AISS
GO:0009636GO-bp Annotation by Michelle Graham. GO Biological Process: response to toxin SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0004003GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP-dependent DNA helicase activity SoyBaseN/AISS
GO:0004386GO-mf Annotation by Michelle Graham. GO Molecular Function: helicase activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0008026GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP-dependent helicase activity SoyBaseN/AISS
GO:0016787GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity SoyBaseN/AISS
PTHR11274Panther RAD25/XP-B DNA REPAIR HELICASE JGI ISS
UniRef100_D7MIW4UniRef Annotation by Michelle Graham. Most informative UniRef hit: DNA repair and transcription factor XPB1 n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7MIW4_ARALL SoyBaseE_val: 1.00E-42ISS
UniRef100_I1K6G2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K6G2_SOYBN SoyBaseE_val: 6.00E-46ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g49196 not represented in the dataset

Glyma18g49196 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g257500 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma18g49196.1   sequence type=CDS   gene model=Glyma18g49196   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCAGGCACTTTACGTGATGAATCCTAATAAGTTCAGAGCATGTGAGTTTCTCATAAATTTCCATGAAAGGACATGTGGTGATAAAATTATAGTCTTTGCTGATAATCTGTTTGCTCTCACTGAGTATGCTATGAAACTCCGTAAACCAATGATATATGGTGTTACAAGTCATGTTGAGAGGACAAAAATTTTGCAAGCATTCAAAACTAGCAAAGATATAAATACTATTTTTCTTTCCAAGGGAAAGCTTGAGGATAGGATGGTAGGGGCAAGGAGGAGTATAATGCATTTTTTCATTCCCTTGTTTCAATTGATACCCAGAGATGTATTACTCAACTAA

>Glyma18g49196.1   sequence type=predicted peptide   gene model=Glyma18g49196   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MQALYVMNPNKFRACEFLINFHERTCGDKIIVFADNLFALTEYAMKLRKPMIYGVTSHVERTKILQAFKTSKDINTIFLSKGKLEDRMVGARRSIMHFFIPLFQLIPRDVLLN*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo