SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma18g49110

Feature Type:gene_model
Chromosome:Gm18
Start:58493633
stop:58498394
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G28715AT Annotation by Michelle Graham. TAIR10: ATPase, V0/A0 complex, subunit C/D | chr3:10778025-10780350 FORWARD LENGTH=351 SoyBaseE_val: 0ISS
GO:0015991GO-bp Annotation by Michelle Graham. GO Biological Process: ATP hydrolysis coupled proton transport SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0033177GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting two-sector ATPase complex, proton-transporting domain SoyBaseN/AISS
GO:0033179GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting V-type ATPase, V0 domain SoyBaseN/AISS
GO:0015078GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrogen ion transmembrane transporter activity SoyBaseN/AISS
GO:0046961GO-mf Annotation by Michelle Graham. GO Molecular Function: proton-transporting ATPase activity, rotational mechanism SoyBaseN/AISS
KOG2957 KOG Vacuolar H+-ATPase V0 sector, subunit d JGI ISS
PTHR11028Panther VACUOLAR ATP SYNTHASE SUBUNIT AC39 JGI ISS
PF01992PFAM ATP synthase (C/AC39) subunit JGI ISS
UniRef100_B6VAX6UniRef Annotation by Michelle Graham. Best UniRef hit: Vacuolar ATPase subunit d n=1 Tax=Vigna radiata RepID=B6VAX6_VIGRA SoyBaseE_val: 0ISS
UniRef100_B6VAX6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Vacuolar ATPase subunit d n=1 Tax=Vigna radiata RepID=B6VAX6_VIGRA SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma09g37520 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g256200 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma18g49110.1   sequence type=CDS   gene model=Glyma18g49110   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTACGGATTCGAAGCTCTCACCTTCAACATCCATGGCGGCTTCCTCGAGGCCATCGTCCGCGGCCACCGCGCCGGCCTCCTCACCACCGCCGATTACAACAACCTCTGCCAATGCGAAACCCTCGACGACATCAAGATGCACCTCTCCGCCACCGAGTACGGTCCTTACCTCCAAAACGAGCCTTCTCCGTTGCATACCACCACGATTGTCGAGAAGTGTACTCTTAAGCTGGTTGATGATTACAAGAACATGCTATGCCAAGCCACAGAACCGTTGTCAACCTTTTTAGAGTATATCACATATGGTCACATGATAGACAATGTTGTTTTGATTGTTACTGGCACCTTGCATGAGAGAGATGTTCAAGAATTATTAGAAAAGTGCCATCCACTCGGCATGTTTGACAGTATTGCTACTCTGGCTGTTGCTCAGAATATGCGGGAGCTTTACAGGCTGGTTCTTGTTGACACTCCTCTGGCTCCATACTTCTCTGAGTGCATTACATCAGAGGACTTGGATGATATGAACATTGAAATAATGAGGAACACTCTTTACAAGGCATACCTTGAAGACTTCTACAGATTTTGTCAGAAACTTGGTGGTGCCACAGCTGAGATAATGTCTGACCTTCTAGCTTTTGAGGCTGATAGAAGGGCTGTGAATATTACCATAAATAGCATTGGTACTGAGCTTACCAGAGATGACCGTAGAAAATTATACTCTAATTTTGGTTTGCTATACCCATATGGTCATGAGGAACTTGCTGTCTGTGAGGACATTGATCAGGTTCGTGCTGTCATGGAAAAATATCCCCCCTATCAATCTATTTTTGCTAAGCTATCATATGGAGAGAGCCAGATGCTTGACAAGGCATTCTATGAGGAGGAGGTGAAAAGGCTTTGCTTGGCATTTGAGCAACAGTTTCATTATGCTGTGTTCTTCGCATATATGAGGTTAAGGGAACAGGAGATCAGGAACTTAATGTGGATTTCAGAATGTGTTGCTCAGAATCAGAAGTCCAGAGTTCATGACAGTGTTGTCTTCATATTTTAG

>Glyma18g49110.1   sequence type=predicted peptide   gene model=Glyma18g49110   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MYGFEALTFNIHGGFLEAIVRGHRAGLLTTADYNNLCQCETLDDIKMHLSATEYGPYLQNEPSPLHTTTIVEKCTLKLVDDYKNMLCQATEPLSTFLEYITYGHMIDNVVLIVTGTLHERDVQELLEKCHPLGMFDSIATLAVAQNMRELYRLVLVDTPLAPYFSECITSEDLDDMNIEIMRNTLYKAYLEDFYRFCQKLGGATAEIMSDLLAFEADRRAVNITINSIGTELTRDDRRKLYSNFGLLYPYGHEELAVCEDIDQVRAVMEKYPPYQSIFAKLSYGESQMLDKAFYEEEVKRLCLAFEQQFHYAVFFAYMRLREQEIRNLMWISECVAQNQKSRVHDSVVFIF*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo