Glyma18g49110 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g49110

Feature Type:	gene_model
Chromosome:	Gm18
Start:	58493633
stop:	58498394
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g49110

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G28715	AT	Annotation by Michelle Graham. TAIR10: ATPase, V0/A0 complex, subunit C/D \| chr3:10778025-10780350 FORWARD LENGTH=351	SoyBase	E_val: 0	ISS
GO:0015991	GO-bp	Annotation by Michelle Graham. GO Biological Process: ATP hydrolysis coupled proton transport	SoyBase	N/A	ISS
GO:0005773	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuole	SoyBase	N/A	ISS
GO:0005774	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane	SoyBase	N/A	ISS
GO:0005794	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus	SoyBase	N/A	ISS
GO:0009506	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma	SoyBase	N/A	ISS
GO:0033177	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting two-sector ATPase complex, proton-transporting domain	SoyBase	N/A	ISS
GO:0033179	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting V-type ATPase, V0 domain	SoyBase	N/A	ISS
GO:0015078	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydrogen ion transmembrane transporter activity	SoyBase	N/A	ISS
GO:0046961	GO-mf	Annotation by Michelle Graham. GO Molecular Function: proton-transporting ATPase activity, rotational mechanism	SoyBase	N/A	ISS
KOG2957	KOG	Vacuolar H+-ATPase V0 sector, subunit d	JGI		ISS
PTHR11028	Panther	VACUOLAR ATP SYNTHASE SUBUNIT AC39	JGI		ISS
PF01992	PFAM	ATP synthase (C/AC39) subunit	JGI		ISS
UniRef100_B6VAX6	UniRef	Annotation by Michelle Graham. Best UniRef hit: Vacuolar ATPase subunit d n=1 Tax=Vigna radiata RepID=B6VAX6_VIGRA	SoyBase	E_val: 0	ISS
UniRef100_B6VAX6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Vacuolar ATPase subunit d n=1 Tax=Vigna radiata RepID=B6VAX6_VIGRA	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma18g49110

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g49110

Paralog	Evidence	Comments
Glyma09g37520	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g49110 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g256200	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g49110

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g49110

Limit To All Plant Sequences

>Glyma18g49110.1   sequence type=CDS   gene model=Glyma18g49110   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTACGGATTCGAAGCTCTCACCTTCAACATCCATGGCGGCTTCCTCGAGGCCATCGTCCGCGGCCACCGCGCCGGCCTCCTCACCACCGCCGATTACAACAACCTCTGCCAATGCGAAACCCTCGACGACATCAAGATGCACCTCTCCGCCACCGAGTACGGTCCTTACCTCCAAAACGAGCCTTCTCCGTTGCATACCACCACGATTGTCGAGAAGTGTACTCTTAAGCTGGTTGATGATTACAAGAACATGCTATGCCAAGCCACAGAACCGTTGTCAACCTTTTTAGAGTATATCACATATGGTCACATGATAGACAATGTTGTTTTGATTGTTACTGGCACCTTGCATGAGAGAGATGTTCAAGAATTATTAGAAAAGTGCCATCCACTCGGCATGTTTGACAGTATTGCTACTCTGGCTGTTGCTCAGAATATGCGGGAGCTTTACAGGCTGGTTCTTGTTGACACTCCTCTGGCTCCATACTTCTCTGAGTGCATTACATCAGAGGACTTGGATGATATGAACATTGAAATAATGAGGAACACTCTTTACAAGGCATACCTTGAAGACTTCTACAGATTTTGTCAGAAACTTGGTGGTGCCACAGCTGAGATAATGTCTGACCTTCTAGCTTTTGAGGCTGATAGAAGGGCTGTGAATATTACCATAAATAGCATTGGTACTGAGCTTACCAGAGATGACCGTAGAAAATTATACTCTAATTTTGGTTTGCTATACCCATATGGTCATGAGGAACTTGCTGTCTGTGAGGACATTGATCAGGTTCGTGCTGTCATGGAAAAATATCCCCCCTATCAATCTATTTTTGCTAAGCTATCATATGGAGAGAGCCAGATGCTTGACAAGGCATTCTATGAGGAGGAGGTGAAAAGGCTTTGCTTGGCATTTGAGCAACAGTTTCATTATGCTGTGTTCTTCGCATATATGAGGTTAAGGGAACAGGAGATCAGGAACTTAATGTGGATTTCAGAATGTGTTGCTCAGAATCAGAAGTCCAGAGTTCATGACAGTGTTGTCTTCATATTTTAG

Predicted protein sequences of Glyma18g49110

Limit To All Plant Sequences

>Glyma18g49110.1   sequence type=predicted peptide   gene model=Glyma18g49110   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MYGFEALTFNIHGGFLEAIVRGHRAGLLTTADYNNLCQCETLDDIKMHLSATEYGPYLQNEPSPLHTTTIVEKCTLKLVDDYKNMLCQATEPLSTFLEYITYGHMIDNVVLIVTGTLHERDVQELLEKCHPLGMFDSIATLAVAQNMRELYRLVLVDTPLAPYFSECITSEDLDDMNIEIMRNTLYKAYLEDFYRFCQKLGGATAEIMSDLLAFEADRRAVNITINSIGTELTRDDRRKLYSNFGLLYPYGHEELAVCEDIDQVRAVMEKYPPYQSIFAKLSYGESQMLDKAFYEEEVKRLCLAFEQQFHYAVFFAYMRLREQEIRNLMWISECVAQNQKSRVHDSVVFIF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain