Glyma18g49080 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g49080

Feature Type:	gene_model
Chromosome:	Gm18
Start:	58469077
stop:	58472330
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g49080

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G15100	AT	Annotation by Michelle Graham. TAIR10: Auxin efflux carrier family protein \| chr5:4892159-4893937 REVERSE LENGTH=367	SoyBase	E_val: 5.00E-133	ISS
GO:0009555	GO-bp	Annotation by Michelle Graham. GO Biological Process: pollen development	SoyBase	N/A	ISS
GO:0009926	GO-bp	Annotation by Michelle Graham. GO Biological Process: auxin polar transport	SoyBase	N/A	ISS
GO:0010252	GO-bp	Annotation by Michelle Graham. GO Biological Process: auxin homeostasis	SoyBase	N/A	ISS
GO:0010315	GO-bp	Annotation by Michelle Graham. GO Biological Process: auxin efflux	SoyBase	N/A	ISS
GO:0005783	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0005215	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transporter activity	SoyBase	N/A	ISS
GO:0009672	GO-mf	Annotation by Michelle Graham. GO Molecular Function: auxin:hydrogen symporter activity	SoyBase	N/A	ISS
PF03547	PFAM	Membrane transport protein	JGI		ISS
UniRef100_Q5FV66	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Auxin efflux carrier protein n=1 Tax=Medicago truncatula RepID=Q5FV66_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_UPI000233E9CA	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233E9CA related cluster n=1 Tax=unknown RepID=UPI000233E9CA	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma18g49080

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g49080

Paralog	Evidence	Comments
Glyma09g37561	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g49080 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g255800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g49080

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g49080

Limit To All Plant Sequences

>Glyma18g49080.1   sequence type=CDS   gene model=Glyma18g49080   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATTTCCTTAGCCGATGCCTATCATGTAGTGGCAGCCACTGTCCCATTATATGTGACCTTGATACTGGCCTACATTTCTGTGAAATGGTGGAAGATCTTCACACCAGATCAATGTTCAGGCATAAACAAATTTGTGGCCAAGTTCTCTATCCCACTTTTGTCTTTTCAAGTCATTTCCTCCAACAACATCTACAAAATGAGCCTCAAACTCATGTATGCCGACTTTCTCCAGAAATTGCTTGCATTTCTTCTCTTAATAGCAATCACTAAGATCAGTGGCCGAGGAGGTTTGAAGTGGATCATAACCGGTTTGTCATTAACAACACTTCCTAACACTTTGATCCTTGGAATCCCTCTCATGAAGGCTATGTATAAGGGTGAAGCAGTTGTTCTCCTTGCACAGATTATTTTCTTGCAGAGCATGATTTGGTACAATTTGCTGTTGTTCCTTTATGAACTTGATGCCGTCAACAAGACCAGGCCTACTGCAGCCGCACCACCATCACAAGGATCTGGAGAAACAGACACAGCTCGTGAAGTACAATCAAAAAGAGAAGAAGACGCAGAACCTAGAATAAAAAGGAAGATGAAGGTCATGCTCATTCTTGTCACAGTGGGAAAGAAGCTAATCAGAAATCCTAATACATATGCAACTTTATTGGGTTTTATTTGGTCAAGCATACAATTCAGGTGGGGATTACATATGCCTGAAGTTGTTAATCAGTCAATAGAAATATTGTCCAATGGAGGTCTTGGCATGGCAATGTTCAGCCTAGGTCTGTTTATGGCATCACAGTCAAGCATCATAGCATGTGGGCCAAGGATGACAATGGTGGCAATAGGACTGAAAGTTGTGCTTGGACCTGCTCTGATGGCTGTGGCATCCCTTGTGATTGGATTAAGAGACAAACTGTTTAAAGTGGCAATTGTTCAGGCAGCTCTACCCCAAGGAATTGTTCCTTTTGTTTTTGCCAAGGAGTATAATGTCCATCCAGCCGTTTTAAGCACTGCGATCTTGTTAGGAATGCTCATTGCCTTGCCGGTGGAATTGGCCTTCTACTTCCTATTAGCAATTTGA

Predicted protein sequences of Glyma18g49080

Limit To All Plant Sequences

>Glyma18g49080.1   sequence type=predicted peptide   gene model=Glyma18g49080   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MISLADAYHVVAATVPLYVTLILAYISVKWWKIFTPDQCSGINKFVAKFSIPLLSFQVISSNNIYKMSLKLMYADFLQKLLAFLLLIAITKISGRGGLKWIITGLSLTTLPNTLILGIPLMKAMYKGEAVVLLAQIIFLQSMIWYNLLLFLYELDAVNKTRPTAAAPPSQGSGETDTAREVQSKREEDAEPRIKRKMKVMLILVTVGKKLIRNPNTYATLLGFIWSSIQFRWGLHMPEVVNQSIEILSNGGLGMAMFSLGLFMASQSSIIACGPRMTMVAIGLKVVLGPALMAVASLVIGLRDKLFKVAIVQAALPQGIVPFVFAKEYNVHPAVLSTAILLGMLIALPVELAFYFLLAI*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain