Glyma18g48343 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g48343

Feature Type:	gene_model
Chromosome:	Gm18
Start:	57778444
stop:	57779408
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g48343

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G44730	AT	Annotation by Michelle Graham. TAIR10: Alcohol dehydrogenase transcription factor Myb/SANT-like family protein \| chr2:18437447-18438565 REVERSE LENGTH=372	SoyBase	E_val: 6.00E-60	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
KOG4282	KOG	Transcription factor GT-2 and related proteins, contains trihelix DNA-binding/SANT domain	JGI		ISS
PF10545	PFAM	Alcohol dehydrogenase transcription factor Myb/SANT-like	JGI		ISS
UniRef100_A2Q1W1	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: MADF; Homeodomain-like n=1 Tax=Medicago truncatula RepID=A2Q1W1_MEDTR	SoyBase	E_val: 6.00E-81	ISS
UniRef100_I1L649	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L649_SOYBN	SoyBase	E_val: 6.00E-149	ISS

Expression Patterns of Glyma18g48343

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g48343 not represented in the dataset	Glyma18g48343 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g48343

Paralog	Evidence	Comments
Glyma09g38050	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g48343 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma18g48343

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g48343

Limit To All Plant Sequences

>Glyma18g48343.1   sequence type=CDS   gene model=Glyma18g48343   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCTCCCCTTCTTCCCCCACCGACTCCAACCCACCCTCTGCCGTCCCCCTCCCTCTCCCGGCGCCTCCCGCCACCTCCTCCCGCCGCCTTCCTCCTCCCTGCTGGACCCCGGAGGAAACCGCCGCCCTCATCGACGCCTACCGCGACAAATGGTACTCCCTCGGCCGCACCAACCTGAAGGCTACCCACTGGCAAGAGGTGGCCGACGCCGTCACCGCGCAGTGCCCCAACGCCTCCCCCACGGCGAAAACCGCCGTGCAGTGCCGCCACAAGATGGAGAAGCTCCGCAAACGCTACCGCACCGAAATCCAACGCGGGGCGCAACCTCCCCTTCCCCCGCGGGGGGGGACGCCAACACCAATTCCCCTTCCTCGCCCCAACCACAAACCCCACTCCGACATCAACAACAACCTCAATTTCCACGATGACGACGACGACGACTATCTGTACGAGGAATTCAAAACCGCCCCCGGATCCAACACCAACACGAGAAGCCTCAACAAGCTCTACAAGAACAACAACGGATTCAATTCGGGTGGTTCGGGCTCCGGATCCGGGTTTCGGATTCGGATCCCGGCCGGCGTGCCACAACAACAACATACGGCGTCGTCTAATAAGATTTTCAACAGCCATCTTCCTCCCGGGATAGTGCCACGTGGCGGAGGCGTGAAGAGGGAGCGTGAGAGGGACGCGGTGGCGGAGATGGTGGAGGCGATTAAGGTCCTTCGCGACGGGTTCGTGAGGATGGAGCAGATGAAGATGGAGATGGCGAGGGAGATCGAGAGCATGCGGATGGAGATGGAGATGAAGCGCACCGAGATGATCCTGGACTCGCAGCAGAGGATTGTTGAGGCTTTTGCAATGGCCGTTTCGCAGAAGAGGAGCAAGGGCAAGTCCACGCCCTCACCTTCATCGCAACCGTAG

Predicted protein sequences of Glyma18g48343

Limit To All Plant Sequences

>Glyma18g48343.1   sequence type=predicted peptide   gene model=Glyma18g48343   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASPSSPTDSNPPSAVPLPLPAPPATSSRRLPPPCWTPEETAALIDAYRDKWYSLGRTNLKATHWQEVADAVTAQCPNASPTAKTAVQCRHKMEKLRKRYRTEIQRGAQPPLPPRGGTPTPIPLPRPNHKPHSDINNNLNFHDDDDDDYLYEEFKTAPGSNTNTRSLNKLYKNNNGFNSGGSGSGSGFRIRIPAGVPQQQHTASSNKIFNSHLPPGIVPRGGGVKRERERDAVAEMVEAIKVLRDGFVRMEQMKMEMAREIESMRMEMEMKRTEMILDSQQRIVEAFAMAVSQKRSKGKSTPSPSSQP*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain