Glyma18g47890 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma18g47890): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma18g47890): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma18g47890

Feature Type:	gene_model
Chromosome:	Gm18
Start:	57438817
stop:	57444067
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g47890

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G65260	AT	Annotation by Michelle Graham. TAIR10: plastid transcriptionally active 4 \| chr1:24236329-24240428 FORWARD LENGTH=330	SoyBase	E_val: 2.00E-145	ISS
GO:0010027	GO-bp	Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization	SoyBase	N/A	ISS
GO:0016050	GO-bp	Annotation by Michelle Graham. GO Biological Process: vesicle organization	SoyBase	N/A	ISS
GO:0009295	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleoid	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009508	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plastid chromosome	SoyBase	N/A	ISS
GO:0009534	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid	SoyBase	N/A	ISS
GO:0009535	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0009941	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
PF04012	PFAM	PspA/IM30 family	JGI		ISS
UniRef100_O80796	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Membrane-associated protein VIPP1, chloroplastic n=1 Tax=Arabidopsis thaliana RepID=VIPP1_ARATH	SoyBase	E_val: 9.00E-143	ISS
UniRef100_UPI000233E6F6	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233E6F6 related cluster n=1 Tax=unknown RepID=UPI000233E6F6	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma18g47890

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g47890 not represented in the dataset	Glyma18g47890 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma18g47890 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g243700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g47890

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g47890

Limit To All Plant Sequences

>Glyma18g47890.1   sequence type=CDS   gene model=Glyma18g47890   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCATTGCTATGAAGGCCACGCCTATCACGGCTTCGGGCTTCGTTTCAACAAGAAATTCCACACTTCCACCCTTTAAATCATCATTTCTCAGATACCGCTCAGGAGCATTGGAAGTTCCTGGCATGCGGGTAACCTACTCAGATAGATTGAAATGTAATTGTCATGGTGGCGGTGCCCTTGGCACTCAAATGAATCTTTTTAGCAGATTTGCTAGAGTTATCAAGTCATATGCTAATGCCATTATAAGCTCCTTTGAAGACCCTGAGAAGATATTAGAACAAGCTGTGCTGGATATGAACAATGATTTGATCAAGGTTCGCCAAGCTACAGCACAGGTTCTAGCATCTCAAAAGCAGTTAGAAAGCAAGTACAAATCCATAGAAAAAGCTTCTGATGATTGGTATCGAAGGGCGCAACTTGCTCTTCAGAAGGGAGACGAGGAACTTGCCCGTGAGGCACTTAAGAGAAGAAAGTCTTATGCGGATAATGCAACTGCTTTGAAGATGCAGCTTGATCAGCAAAAGAATGTTGCTGATGATCTTGTGTCCAAAACACAGCTTTTGGAGAGCAAGATACAGGAGGCAAAGTCAAAGAAAGATACCCTCAAAGCAAGAGCTCAGTCTGCAAAGACTTCAACCATAGTTAGTGAGATGGTGGGCAATATCAACACAAGCAGTGCCCTTGCAGCTTTTGATAAGATGGAGGAAAAGGTATTAACCATGGAGGCTCAGGCAGATGCTTTGAATCAGTTGAGTACTGACAATCTTGAGGGAAAGTTTGCACTACTGGAGAACTCTTCTGTCGATGATGATCTTGCAGAGTTAAAGAAAGAATTATCTGGAAGCTCTAAGCGGGGAGAACTTCCACCTGGAAGAAGTGTTCCAACCAGTAAAGAAATTCCCTTCCTTGACTTGGAGCTTGAGAAGGAGCTTAATGAGCTCAGAAGAAGAGCAAAGGGGTACTAG

Predicted protein sequences of Glyma18g47890

Limit To All Plant Sequences

>Glyma18g47890.1   sequence type=predicted peptide   gene model=Glyma18g47890   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAIAMKATPITASGFVSTRNSTLPPFKSSFLRYRSGALEVPGMRVTYSDRLKCNCHGGGALGTQMNLFSRFARVIKSYANAIISSFEDPEKILEQAVLDMNNDLIKVRQATAQVLASQKQLESKYKSIEKASDDWYRRAQLALQKGDEELAREALKRRKSYADNATALKMQLDQQKNVADDLVSKTQLLESKIQEAKSKKDTLKARAQSAKTSTIVSEMVGNINTSSALAAFDKMEEKVLTMEAQADALNQLSTDNLEGKFALLENSSVDDDLAELKKELSGSSKRGELPPGRSVPTSKEIPFLDLELEKELNELRRRAKGY*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain