SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g47875

Feature Type:gene_model
Chromosome:Gm18
Start:57431815
stop:57436896
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g47875
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G16390AT Annotation by Michelle Graham. TAIR10: chloroplastic acetylcoenzyme A carboxylase 1 | chr5:5361098-5363020 REVERSE LENGTH=280 SoyBaseE_val: 6.00E-70ISS
GO:0000271GO-bp Annotation by Michelle Graham. GO Biological Process: polysaccharide biosynthetic process SoyBaseN/AISS
GO:0006084GO-bp Annotation by Michelle Graham. GO Biological Process: acetyl-CoA metabolic process SoyBaseN/AISS
GO:0006633GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid biosynthetic process SoyBaseN/AISS
GO:0009664GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall organization SoyBaseN/AISS
GO:0009825GO-bp Annotation by Michelle Graham. GO Biological Process: multidimensional cell growth SoyBaseN/AISS
GO:0009832GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall biogenesis SoyBaseN/AISS
GO:0009932GO-bp Annotation by Michelle Graham. GO Biological Process: cell tip growth SoyBaseN/AISS
GO:0010075GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of meristem growth SoyBaseN/AISS
GO:0010817GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hormone levels SoyBaseN/AISS
GO:0016126GO-bp Annotation by Michelle Graham. GO Biological Process: sterol biosynthetic process SoyBaseN/AISS
GO:0016132GO-bp Annotation by Michelle Graham. GO Biological Process: brassinosteroid biosynthetic process SoyBaseN/AISS
GO:0043481GO-bp Annotation by Michelle Graham. GO Biological Process: anthocyanin accumulation in tissues in response to UV light SoyBaseN/AISS
GO:0048653GO-bp Annotation by Michelle Graham. GO Biological Process: anther development SoyBaseN/AISS
GO:0048767GO-bp Annotation by Michelle Graham. GO Biological Process: root hair elongation SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0009317GO-cc Annotation by Michelle Graham. GO Cellular Compartment: acetyl-CoA carboxylase complex SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009536GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastid SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0003989GO-mf Annotation by Michelle Graham. GO Molecular Function: acetyl-CoA carboxylase activity SoyBaseN/AISS
GO:0009374GO-mf Annotation by Michelle Graham. GO Molecular Function: biotin binding SoyBaseN/AISS
PTHR23151Panther DIHYDROLIPOAMIDE ACETYL/SUCCINYL-TRANSFERASE-RELATED JGI ISS
PTHR23151:SF25Panther BCCP2 (BIOTIN CARBOXYL CARRIER PROTEIN 2), BIOTIN JGI ISS
PF00364PFAM Biotin-requiring enzyme JGI ISS
UniRef100_Q42783UniRef Annotation by Michelle Graham. Best UniRef hit: Biotin carboxyl carrier protein of acetyl-CoA carboxylase, chloroplastic n=2 Tax=Glycine max RepID=BCCP_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q42783UniRef Annotation by Michelle Graham. Most informative UniRef hit: Biotin carboxyl carrier protein of acetyl-CoA carboxylase, chloroplastic n=2 Tax=Glycine max RepID=BCCP_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma18g47875
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g47875 not represented in the dataset
Glyma18g47875 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g47875
ParalogEvidenceComments
Glyma09g38440 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g47875 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g243500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g47875
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g47875
>Glyma18g47875.1   sequence type=CDS   gene model=Glyma18g47875   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCATCCTCGTTGGCACCAGCTACCAAAGCCGCCACTAATTTGCGCCTCACACACTCTCTCCGCTTCTCTCCTAAACCCAACAACCTACGCTTTGCCACCAAGCCTGGTAATACGCTGTTATGCACGAGGGTTAAGGCCCAATTAAATGAGGTTGCCCTTGATAGTTCCTCCAATGCTACTTCTCCTCCTATGAAAGCCAAATCAAAGGAGGAACCACCCGCAAAGCCTTTAGCAGAACCATCTTCTTCAGTGTTGGCAACTCAAGAATCGGTCTCTCAGTTTATTACTCAAGTTGCAAGTCTTGTCAAGCTTGTTGATTCAAGAGACATTGTGGAGTTGAAGCTGAAGCAGCATGACGTTGAAGTAACAATCAGGAAAAAGGAGGCTATGCCTCAGCCACCACCTGCTCCTCAACCTTCTGTGGTGTATTCACCCCCTCCACCAGCGTTGCCACCACCACCTGTACCAGCATCTACTCCAGCACCTACTCTAGCTCGTGCAACCCCTACACCAACTTCAGCCCCTGCTGTGAAGTCAGCTAAATCATCACTTCCGCCTCTTAAAAGCCCCATGGCAGGGACATTCTACCGAAGTCCTGCACCTGGTGAACCTTCCTTTGTGAAGGTTGGAGACAAAGTAAAGAAGGGGCAAGTTGTATGCATCATTGAGGCAATGAAATTGATGAATGAAATTGAAGCTGATCAGTCAGGAACTATAGTTGAAATCGTTGCGGAAGATGCCAAGTCTGTAAGCGTTGACACTCCCCTATTTGTGATTCAACCATAG
Predicted protein sequences of Glyma18g47875
>Glyma18g47875.1   sequence type=predicted peptide   gene model=Glyma18g47875   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASSLAPATKAATNLRLTHSLRFSPKPNNLRFATKPGNTLLCTRVKAQLNEVALDSSSNATSPPMKAKSKEEPPAKPLAEPSSSVLATQESVSQFITQVASLVKLVDSRDIVELKLKQHDVEVTIRKKEAMPQPPPAPQPSVVYSPPPPALPPPPVPASTPAPTLARATPTPTSAPAVKSAKSSLPPLKSPMAGTFYRSPAPGEPSFVKVGDKVKKGQVVCIIEAMKLMNEIEADQSGTIVEIVAEDAKSVSVDTPLFVIQP*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo