SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g47775

Feature Type:gene_model
Chromosome:Gm18
Start:57343426
stop:57347827
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g47775
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G02960AT Annotation by Michelle Graham. TAIR10: RING/FYVE/PHD zinc finger superfamily protein | chr2:862346-863980 REVERSE LENGTH=271 SoyBaseE_val: 5.00E-21ISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
PF00097PFAM Zinc finger, C3HC4 type (RING finger) JGI ISS
UniRef100_G7L0Z7UniRef Annotation by Michelle Graham. Most informative UniRef hit: E3 ubiquitin-protein ligase MARCH3 n=1 Tax=Medicago truncatula RepID=G7L0Z7_MEDTR SoyBaseE_val: 2.00E-48ISS
UniRef100_UPI000233EE12UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233EE12 related cluster n=1 Tax=unknown RepID=UPI000233EE12 SoyBaseE_val: 1.00E-174ISS

Expression Patterns of Glyma18g47775
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g47775 not represented in the dataset
Glyma18g47775 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g47775
ParalogEvidenceComments
Glyma09g38541 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g47775 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g242400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g47775
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g47775
>Glyma18g47775.1   sequence type=CDS   gene model=Glyma18g47775   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCCGGTTTACATCATGGGAGATCATGTAACTGTCTCGACCACTCAACAACACATTGCAATCCCCATTGAGAAATTGAATGCATTATCACTTGAAGTTGCAAAGGAAGAAAAACATGTAACCGATGATGCCTATGTGGACAATGTCCAAAAACCTGAAGAGAAAGATGAAGAAACTCAAGAAAAGGGAGATTGTCGCTACTGTCAAGAAGAGGACTTTATTTTTAATATGGAATCACCCTGCAATTGCAATGGTAGCGTGAAGTATGTTCACAAGAGATGCATTGATCAATGGTACAATTCCAAAGGCCGCATGATATTATGTGAGATTTGCAGGAAGCCTTACAATCCAAATGATTACCCACTTCCGGAACTTCATTATGATGATGATGACACCGAGATAACTATATTAAGGGAGGAATGGACTATTCCTGGAACCAGCATTGAAATTTGGTCACCTTTGGTGCTGGCAGACCGTGCCACCAAGGGCCTCATTGATTCAATGAACAAAGACTTCAGCTTGAAAAACCCTAGTGGAGGTGTGATATTTGGCATGTCACTCGTCATCTTTATCGCGGTGCTACTTATAAAGGATGCCTATGAATGTGCGCCACCCAAGGAGGAGAAATTTGCTCGTTTTTTGTACTGCGCTGTGATGACTATCTCTGTGCCAGTTTACATTTTATCGTGGGTTTTACAGTGCCAAGCCTATAGAAAAAGCGAGAGAGGGAGGGAAAGAGAAAGACATCGCAATGCATAG
Predicted protein sequences of Glyma18g47775
>Glyma18g47775.1   sequence type=predicted peptide   gene model=Glyma18g47775   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MPVYIMGDHVTVSTTQQHIAIPIEKLNALSLEVAKEEKHVTDDAYVDNVQKPEEKDEETQEKGDCRYCQEEDFIFNMESPCNCNGSVKYVHKRCIDQWYNSKGRMILCEICRKPYNPNDYPLPELHYDDDDTEITILREEWTIPGTSIEIWSPLVLADRATKGLIDSMNKDFSLKNPSGGVIFGMSLVIFIAVLLIKDAYECAPPKEEKFARFLYCAVMTISVPVYILSWVLQCQAYRKSERGRERERHRNA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo