Glyma18g47510 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g47510

Feature Type:	gene_model
Chromosome:	Gm18
Start:	57139772
stop:	57141283
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g47510

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G13230	AT	Annotation by Michelle Graham. TAIR10: Late embryogenesis abundant protein (LEA) family protein \| chr4:7675841-7676629 REVERSE LENGTH=120	SoyBase	E_val: 2.00E-13	ISS
GO:0009793	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
UniRef100_Q2HV86	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Late embryogenesis abundant protein n=1 Tax=Medicago truncatula RepID=Q2HV86_MEDTR	SoyBase	E_val: 9.00E-54	ISS
UniRef100_UPI00023388F8	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI00023388F8 related cluster n=1 Tax=unknown RepID=UPI00023388F8	SoyBase	E_val: 3.00E-85	ISS

Expression Patterns of Glyma18g47510

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g47510

Paralog	Evidence	Comments
Glyma09g38810	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g47510 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g240000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g47510

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g47510

Limit To All Plant Sequences

>Glyma18g47510.2   sequence type=CDS   gene model=Glyma18g47510   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAAGCTTCACCCTAGTCACATCCCTCCCAAAGTTTGGCCATGCTGGAGCAGCAATTGCTAGGACTCGTGTCTGGAATCCTAGGGTTTTCGCAGCTGCTACACCTAGAACTATCCAAGTTCCAAGAGAAGGACCAGCAACCGCTGAAGGCACCACACAAGGAGCTAGTGAAACAGTCAATAACAGTTTGAACGAAGCGCAAGACAAGGCTTACACCACAGCGGAACATGTGGCTAACAAGACAAATGAGGTGGCTGGTCAGATGTCAGCAAGTGCTCAAAATATGGCTGGTAAAGCAAAGCAGACAATGCAAGAGGCATGGGAATTCAGTAAGAACAAAGCCAATACCGTGGTAGGAAAGACTAAAGAATCAGCTGAACACGCCAAAGATAATGTGGTAGGAAAGACTAAAGAATCAGCTGAATACGTCAAAGATAATGCAGAGGCAGTGAAGAAGAACATGAACTCAAAGAACTGA

Predicted protein sequences of Glyma18g47510

Limit To All Plant Sequences

>Glyma18g47510.2   sequence type=predicted peptide   gene model=Glyma18g47510   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASFTLVTSLPKFGHAGAAIARTRVWNPRVFAAATPRTIQVPREGPATAEGTTQGASETVNNSLNEAQDKAYTTAEHVANKTNEVAGQMSASAQNMAGKAKQTMQEAWEFSKNKANTVVGKTKESAEHAKDNVVGKTKESAEYVKDNAEAVKKNMNSKN*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain