Report for Sequence Feature Glyma18g47300
Feature Type: gene_model
Chromosome: Gm18
Start: 56995337
stop: 56997541
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma18g47300
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT4G01250 AT
Annotation by Michelle Graham. TAIR10: WRKY family transcription factor | chr4:522839-524129 REVERSE LENGTH=298
SoyBase E_val: 1.00E-82 ISS
GO:0002679 GO-bp
Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response
SoyBase N/A ISS
GO:0006355 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0010150 GO-bp
Annotation by Michelle Graham. GO Biological Process: leaf senescence
SoyBase N/A ISS
GO:0010200 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to chitin
SoyBase N/A ISS
GO:0035556 GO-bp
Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0003700 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity
SoyBase N/A ISS
GO:0043565 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding
SoyBase N/A ISS
PF03106 PFAM
WRKY DNA -binding domain
JGI ISS
UniRef100_B0LUR3 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Transcription factor n=1 Tax=Glycine max RepID=B0LUR3_SOYBN
SoyBase E_val: 3.00E-133 ISS
UniRef100_C6T771 UniRef
Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Glycine max RepID=C6T771_SOYBN
SoyBase E_val: 0 ISS
Proteins Associated with Glyma18g47300
Locus Gene Symbol Protein Name
WRKY10 WRKY Transcription Factor
Expression Patterns of Glyma18g47300
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma18g47300
Paralog Evidence Comments
Glyma09g39040 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma18g47300 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.18g238200 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma18g47300
Coding sequences of Glyma18g47300
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma18g47300.1 sequence type=CDS gene model=Glyma18g47300 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGCGGAAGATTGGGATCTACATGCGGTGGTTAGAGGCTGCTCCACCGTTACATCATCCTCAGTGTCTTCTTCTTCATCTCCTTCTTCCTCTGGTTTTGCCTCTTCTTACTTCCACCCTGAAGCTGCAGTTTCTTCTTCTTCTTCTTCCTATTCTGGCTTCAACATCTTCAAGGGTGAACAAGGAATAAGCCAAGTTTTGTCGCTCTCTGCGTACCCCTTTGAGGCAAGGAGCTCCATTGAGGAATTGCATGAGCTTTGCAAACCTTTCTTCTCCAAATCTCAGCCTCTAACGTTGCAAGCCTCTTCACCTTTGTCCTCACTCTCTTCCTATTCCTCTGCGCCACCCAAATCTGTTTCAACGCAAGAGAAACAACAACAGAGGAGCAAGCAGGCACATGCTGTCACCACCCCACGATCTAAAAGAAGAAAGAACCAGCTTAAGAAAGTTTGTCAAGTGCCAGTTGAGAATCTCTCCTCAGACATATGGGCATGGAGGAAATATGGCCAGAAACCCATAAAGGGGTCTCCATATCCAAGGGGGTACTATAGATGTAGCAGCTCAAAGGGGTGTTTGGCAAGGAAACAGGTTGAAAGAAACAGATCAGACCCAACAATGTTTATAGTGACTTACACTGCTGAGCACAACCACCCTGCTCCTACTCACAGAAACTCTCTTGCTGGCTCCACACGTCAGAAGCCATTGGTACCTCAAACAGCCACCACCACTGAAGAAGACTCTGACAAGAGCAAGAGCCTCACAAAACCCACTTCCCCTGCCACCTCAGGGGCAGAAGAAGAGGCTCCAACACCATCACAAGGGGAAAAGTCTGAGAGCAGAGAAGAGAAAGAGGATGTGATGGATGATGAGGAAGAAGATGAATTTGGCTTGTCTGATATGGTGCTTTCAGATGACTTCTTTGAAAGTTTGGATGAACTGAGCCAACTTACGGCTCCTTCTGTTGTCACTGGAGACTGTTTCAGTGACCCCTTTTCAGCAATTGCAATCCCTTCTTGGGTGGCTAGTGGTGCTGCTACTGCTAGTGGGTGTAGATGA
Predicted protein sequences of Glyma18g47300
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma18g47300.1 sequence type=predicted peptide gene model=Glyma18g47300 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MAEDWDLHAVVRGCSTVTSSSVSSSSSPSSSGFASSYFHPEAAVSSSSSSYSGFNIFKGEQGISQVLSLSAYPFEARSSIEELHELCKPFFSKSQPLTLQASSPLSSLSSYSSAPPKSVSTQEKQQQRSKQAHAVTTPRSKRRKNQLKKVCQVPVENLSSDIWAWRKYGQKPIKGSPYPRGYYRCSSSKGCLARKQVERNRSDPTMFIVTYTAEHNHPAPTHRNSLAGSTRQKPLVPQTATTTEEDSDKSKSLTKPTSPATSGAEEEAPTPSQGEKSESREEKEDVMDDEEEDEFGLSDMVLSDDFFESLDELSQLTAPSVVTGDCFSDPFSAIAIPSWVASGAATASGCR*