SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma18g46820

Feature Type:gene_model
Chromosome:Gm18
Start:56524633
stop:56528171
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G45980AT Annotation by Michelle Graham. TAIR10: unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00355.2); Has 93 Blast hits to 90 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 93; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr2:18917680-18918569 REVERSE LENGTH=25 SoyBaseE_val: 9.00E-64ISS
GO:0000902GO-bp Annotation by Michelle Graham. GO Biological Process: cell morphogenesis SoyBaseN/AISS
GO:0006623GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to vacuole SoyBaseN/AISS
GO:0006914GO-bp Annotation by Michelle Graham. GO Biological Process: autophagy SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0016049GO-bp Annotation by Michelle Graham. GO Biological Process: cell growth SoyBaseN/AISS
GO:0016192GO-bp Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport SoyBaseN/AISS
GO:0048193GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi vesicle transport SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum SoyBaseN/AISS
GO:0043231GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular membrane-bounded organelle SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
UniRef100_C6TEL9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TEL9_SOYBN SoyBaseE_val: 0ISS
UniRef100_O82775UniRef Annotation by Michelle Graham. Most informative UniRef hit: Expressed protein n=1 Tax=Arabidopsis thaliana RepID=O82775_ARATH SoyBaseE_val: 4.00E-61ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma09g39450 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g234100 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma18g46820.1   sequence type=CDS   gene model=Glyma18g46820   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAAACAATGAGGATGGAAGGGATAAGACTACTCGTGGGAATGAATGGGAGGTTGTATCTCTGACAGCATCGACATATGCAGCTGCTCCTGGTCCTGATGAAGTTGAGATGAAGGATGATGGGAACGAAGATGTATATGGGCAAGATGAAGGAGAAACGTCAAATGCTTTATTTATGTCTCGTCACTTTGTCTTTCCTCCCAGTCAGCATGAAAACTTGCCCGTGGAACCTGACTATGGTGAGATTCATGATGATTCTGGAGACAAAGATGTTGCCTCTGAAGAGACTCCTGAAGAAGTGACCATACCAAGTGGAAAGGATGAAGAAAACTTGACATTACCAGGATTGGAAGTTTCAGAGGAGTTTGAGGGCATGCGGTATTTTGACGAGAAAATCAACAGATTATCTGTTCGTGGTAAACAGTTTGAGGAAAGTACAACTCTACCAGCATTTGGTTTGACTGAAAAGGGGGAGAGCATGTATGACCCTGCAAAATACACTTCTTTTGACAGTGAAACTGCTATTGGTGGCATAACAGCTTATGGTGAAAGCATAGTTGATCCTGAAACAACTGAATCCGCAGAGCAAGGGTCAAACGTATCTCCTGATCTATCATTGTCAAACTACTCTTCCAAAGATAATGAATACAACTCCTCAGATCTTCCTTGTGGAGCTTGGTGGAAGCGGAGAGCTGCCTCCTTATATGCTCATGCAAAAGAGGCAAATGCATTCTGGTCTGTCTTCATTGCAGCTGCTGTGATGGGTCTTGTAATGCTTGGTCAACGCTGGCAGCAGGAAAGAGCTTTACAACTTAAATGGCAAATCAGTATAAATGATGAGGCGAGGAGCAGGGTGCTTGCTCCCATATATCGACTCAAAGATGTGATTGTTGGTGGCAACCGCCGTGGCTCCTTGATCAGGGGAAGCTCCTCTGGTGAAAGTTAA

>Glyma18g46820.1   sequence type=predicted peptide   gene model=Glyma18g46820   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MANNEDGRDKTTRGNEWEVVSLTASTYAAAPGPDEVEMKDDGNEDVYGQDEGETSNALFMSRHFVFPPSQHENLPVEPDYGEIHDDSGDKDVASEETPEEVTIPSGKDEENLTLPGLEVSEEFEGMRYFDEKINRLSVRGKQFEESTTLPAFGLTEKGESMYDPAKYTSFDSETAIGGITAYGESIVDPETTESAEQGSNVSPDLSLSNYSSKDNEYNSSDLPCGAWWKRRAASLYAHAKEANAFWSVFIAAAVMGLVMLGQRWQQERALQLKWQISINDEARSRVLAPIYRLKDVIVGGNRRGSLIRGSSSGES*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo