Glyma18g46480 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g46480

Feature Type:	gene_model
Chromosome:	Gm18
Start:	56206257
stop:	56209518
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g46480

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G61250	AT	Annotation by Michelle Graham. TAIR10: myb domain protein 17 \| chr3:22671306-22672551 FORWARD LENGTH=299	SoyBase	E_val: 1.00E-120	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0009751	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salicylic acid stimulus	SoyBase	N/A	ISS
GO:0009753	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus	SoyBase	N/A	ISS
GO:0009909	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of flower development	SoyBase	N/A	ISS
GO:0048443	GO-bp	Annotation by Michelle Graham. GO Biological Process: stamen development	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
KOG0048	KOG	Transcription factor, Myb superfamily	JGI		ISS
PTHR10641	Panther	MYB-RELATED	JGI		ISS
PF00249	PFAM	Myb-like DNA-binding domain	JGI		ISS
UniRef100_G7L3J2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: MYB transcription factor n=1 Tax=Medicago truncatula RepID=G7L3J2_MEDTR	SoyBase	E_val: 8.00E-151	ISS
UniRef100_UPI000189D925	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000189D925 related cluster n=1 Tax=unknown RepID=UPI000189D925	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma18g46480

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g46480

Paralog	Evidence	Comments
Glyma09g39721	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g46480 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g230600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g46480

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g46480

Limit To All Plant Sequences

>Glyma18g46480.1   sequence type=CDS   gene model=Glyma18g46480   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAAGAACACCATGTTGTGACAAGAAGGGTTTGAAGAAAGGACCTTGGACAGCTGAAGAGGATGAAATTCTTTCTAGTTATATCAAGAAAAATGGTGGTCATGGAAGCTGGCGTTCTCTTCCAAGGATGGCAGGTCTTCTTCGTTGTGGCAAGAGTTGCAGGCTTAGGTGGACAAACTATCTGAGACCAGACATTAAGCGTGGTCCCTTTACTCTTGAGGAAGAAAAACTAGTCATACAGCTTCATGGCATCCTAGGAAATAGGTGGGCTGCAATAGCCTCTCAGTTACCAGGGAGAACAGACAATGAGATAAAGAACTTATGGAACACCCACTTGAAGAAGCGTCTCAAAAGCATGGGGCTTGACCCCAAAACTCATGAACCATTGGCCTCATCAACTTACCCTTTTCACAAGGCACCTGCATCTGTCTCCACACGCCACATGGCTCAGTGGGAGAGTGCTAGGCTCGAAGCCGAGGCCAGACTCTCGAACGAGTCGTCAAGGTTCAGCCACAACACCACCAACAATTCCAACTCTGATAACAACAAAACCACTGATTCTGACTACTTTCTCCGCATTTGGAACTCTGAAGTTGGAGAGGCATTTCGCAATGTTCATCATCACAAAGCTGATGATGACAACAACAACAACAAAATCACTACTAATACTCCTACTAGTTCCTGCCACAGTCCTCTTTCTACAGGGTCATCTTCCAACAAGTGTGAGTCAATTGCTACAAATGCAGACTTGGCTTCTAATGCACCAGAAATTATCACACCCTCTAGCATTGTGAAACAAGAGTTTGAGTGGGGGACTCGTGGTTCCGACTCGTCAAGCTCTAATGACATGGAAGACTCATCAGACACTGCTTTGCAGCTCTTGTTGGATTTTCCTATAAACAATGACATGAGCTTCTTGGAAGGAAACTCTTTTGTGTGTCCACTTTAG

Predicted protein sequences of Glyma18g46480

Limit To All Plant Sequences

>Glyma18g46480.1   sequence type=predicted peptide   gene model=Glyma18g46480   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGRTPCCDKKGLKKGPWTAEEDEILSSYIKKNGGHGSWRSLPRMAGLLRCGKSCRLRWTNYLRPDIKRGPFTLEEEKLVIQLHGILGNRWAAIASQLPGRTDNEIKNLWNTHLKKRLKSMGLDPKTHEPLASSTYPFHKAPASVSTRHMAQWESARLEAEARLSNESSRFSHNTTNNSNSDNNKTTDSDYFLRIWNSEVGEAFRNVHHHKADDDNNNNKITTNTPTSSCHSPLSTGSSSNKCESIATNADLASNAPEIITPSSIVKQEFEWGTRGSDSSSSNDMEDSSDTALQLLLDFPINNDMSFLEGNSFVCPL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain