Glyma18g45420 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g45420

Feature Type:	gene_model
Chromosome:	Gm18
Start:	55197706
stop:	55199602
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g45420

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G45470	AT	Annotation by Michelle Graham. TAIR10: FASCICLIN-like arabinogalactan protein 8 \| chr2:18742797-18744059 REVERSE LENGTH=420	SoyBase	E_val: 6.00E-166	ISS
GO:0007389	GO-bp	Annotation by Michelle Graham. GO Biological Process: pattern specification process	SoyBase	N/A	ISS
GO:0008361	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of cell size	SoyBase	N/A	ISS
GO:0009664	GO-bp	Annotation by Michelle Graham. GO Biological Process: plant-type cell wall organization	SoyBase	N/A	ISS
GO:0009832	GO-bp	Annotation by Michelle Graham. GO Biological Process: plant-type cell wall biogenesis	SoyBase	N/A	ISS
GO:0009926	GO-bp	Annotation by Michelle Graham. GO Biological Process: auxin polar transport	SoyBase	N/A	ISS
GO:0010015	GO-bp	Annotation by Michelle Graham. GO Biological Process: root morphogenesis	SoyBase	N/A	ISS
GO:0040007	GO-bp	Annotation by Michelle Graham. GO Biological Process: growth	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009505	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plant-type cell wall	SoyBase	N/A	ISS
GO:0031225	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: anchored to membrane	SoyBase	N/A	ISS
GO:0046658	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: anchored to plasma membrane	SoyBase	N/A	ISS
GO:0048046	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: apoplast	SoyBase	N/A	ISS
PTHR10900	Panther	TRANSFORMING GROWTH FACTOR	JGI		ISS
PTHR10900:SF23	Panther	FLA (FASCICLIN-LIKE ARABINOGALACTAN PROTEIN)	JGI		ISS
PF02469	PFAM	Fasciclin domain	JGI		ISS
UniRef100_G7L0C1	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Fasciclin-like arabinogalactan protein n=1 Tax=Medicago truncatula RepID=G7L0C1_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_I1N3G2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N3G2_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma18g45420

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g45420

Paralog	Evidence	Comments
Glyma09g40420	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g45420 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g222200	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g45420

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g45420

Limit To All Plant Sequences

>Glyma18g45420.1   sequence type=CDS   gene model=Glyma18g45420   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCACATTCTCCCTTTCCTCCTCCTCACCCTCCTCGCCGCCACCGCCTCCGCCCACAATATCACCGACATTCTCGCCGCCAACCCCGACTACAGCGACTTCAACGGCTTCCTCTCCCAAACCGGCCTCGCCGGCGAAATCAACACCCGCCAGACCATCACCGTCCTCGTCCTCAACAACGCCGCCCTCTCCGCCGTGGCCGCAAAACACCCCCTCTCCGTCGTCAAAAACCTCCTCAGCCTCCACATCCTCCTCGACTACTTCGACAACACAAAGCTCCACCAGATCCCCAACGGCACCACGCTCTCCACCACTCTCTACCAAACCACCGGCAATGCCAACGGCAACGTCGGCTCCGTCAACATCACCGACCTCAAAGGCGGTAAGGTTGGCTTCGGCTCCGCTGCTCCCGGCTCCAAACTCGACTCCTCCTACACCAAATCCGTCAAACAAATCCCCTACAACATCTCCGTCATGGAAATCAGCGCGCCGATCATTTCGCCGGGGATCCTCGCGGCTCCGCCTCCCTCAGCCGACGTTAACATAACGGCACTCATCGAAAAAGCCGGATGCAAAACGTTCGCCTCACTCATCTCCTCTAACGGACTCATTAAAACGTTTCAGTCAACGGCGGATAAAGGTTTGACTATTTTCGCTCCTAACGATGAAGCGTTTAAGGCGAAAGGCGTACCTGATTTGAGCAAGCTCACGAACGCTGAAGTTGTTTCGCTCTTACAGTATCACGCCGCCGCTAAGTATCTTCCCGTTGGATCTCTGAAAACGACGAAGGATTCAATTAACACGTTGGCCTCCAACGGCGCCGGAAAGTTCGATTTGACCGTTTCCGTCGCCGGAGATTCCCTTACGCTCCACACCGGAGTCGATTCCTCGAGGATAGCGGAGACGATTCTCGATTCCACTCCGCTTTCAATTTATTCTGTGGACAGCGTTCTTCTTCCGCCGGAGCTGTTCGCGAAGTCGCCGTCTCCTGCCCCGGCGCCGGGACCGGTTACTGCGCCTTCTCCCTCGCCGGTGTCAACTCCATCGGAAGCACCTTCGCCGCTTCCGGCATCGCCTCCGGCTCCAGCGGGAGAGACTCCTGCCGGTGCTCCGGCGGATGCACCGTCCTCGGAGGCTGAGCGGAGCACTTCCGGCAAGAGTGACGGTGTTCACGTGAAAGCTTCTGCGACTCTCACTGTTGCAGTGATTGCATTGTCTGCCTTTGTGATTTCTGCTACCTTTATGTAA

Predicted protein sequences of Glyma18g45420

Limit To All Plant Sequences

>Glyma18g45420.1   sequence type=predicted peptide   gene model=Glyma18g45420   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAHILPFLLLTLLAATASAHNITDILAANPDYSDFNGFLSQTGLAGEINTRQTITVLVLNNAALSAVAAKHPLSVVKNLLSLHILLDYFDNTKLHQIPNGTTLSTTLYQTTGNANGNVGSVNITDLKGGKVGFGSAAPGSKLDSSYTKSVKQIPYNISVMEISAPIISPGILAAPPPSADVNITALIEKAGCKTFASLISSNGLIKTFQSTADKGLTIFAPNDEAFKAKGVPDLSKLTNAEVVSLLQYHAAAKYLPVGSLKTTKDSINTLASNGAGKFDLTVSVAGDSLTLHTGVDSSRIAETILDSTPLSIYSVDSVLLPPELFAKSPSPAPAPGPVTAPSPSPVSTPSEAPSPLPASPPAPAGETPAGAPADAPSSEAERSTSGKSDGVHVKASATLTVAVIALSAFVISATFM*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain